Gene detail

Detail information of GWHGAAZE029581

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008218687.1	1.75429E-97	PREDICTED: non-lysosomal glucosylceramidase [Prunus mume]
COG	NP_925406.1	4E-17	hypothetical protein gll2460
trEMBL	tr\|M5XQ56\|M5XQ56_PRUPE	7E-98	Non-lysosomal glucosylceramidase {ECO:0000256\|PIRNR:PIRNR028944}
TAIR10	AT5G49900.1	5E-69	Beta-glucosidase, GBA2 type family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	28951935	28953658	+
GWHAAZE00000009	mRNA	28951935	28953658	+
GWHAAZE00000009	exon	28951935	28952051	+
GWHAAZE00000009	exon	28952193	28952258	+
GWHAAZE00000009	exon	28952786	28952856	+
GWHAAZE00000009	exon	28952938	28952999	+
GWHAAZE00000009	exon	28953273	28953658	+
GWHAAZE00000009	CDS	28951935	28952051	+
GWHAAZE00000009	CDS	28952193	28952258	+
GWHAAZE00000009	CDS	28952786	28952856	+
GWHAAZE00000009	CDS	28952938	28952999	+
GWHAAZE00000009	CDS	28953273	28953658	+

Transcript Sequence
>GWHTAAZE029615 ATGTCAATGCCTTCAGAACTGGGTTCATCTATTGGGGCAGCCATTGCAGCTTCTGTAACAGTTCCATCAGAGGCAGTGCGTACTGTTACGTTTTCATTGGGGTGGGACTGTCCTGAAGCGCTACACCAAATTCTATGGTACTCATGGGGCCTTGAGCAGATATTGCACATGATGCTATTCTTGCATGGACTATGGGAGTCCCAAATAGAATCATGGCAGAGACCTATTCTTGAAGACAAGAGGCTTCCTGAATGGTACCCAATCACTCTTTTCAATGAGCTCTACTACCTTAATTCGGGGGGAACAATTTGGACAGATGGATCACCTCCAATTCATCCTTTATCAAGCATTGGAAAAAGAAAGTTCTCCCTTGATAGAGCCAACATAAATCTCAAAACCGTCATTGATAAATCCCTTCAAAACGACACTGCTGTTGATGTTCTTGAACGGATGGCATCAAAACTCGAGGAGATTCACACTCCAACGTCATCAAATTCCGCACTAGGGACAAATCTACTTCAAAAGGGAGAGCAAAACATCGGTCAATTCCTCTATTTCGAAGGAATTGAATACCATATGTGTAACACATACGACGTTCATTTCTACTCTTCTTTTGCCTTAGCCATGCTTTTCCCCAAACTTCGAACTCAGCATCCAAAGAGACTTTGCTGCAGCAGTGTTGATGCGACCCTGGTAAAATGA

Network for GWHGAAZE029581

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04685.14	DUF608	181	217	2.60E-13

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K17108	GBA2	Metabolic pathways	map01100
		Sphingolipid metabolism	map00600
		Other glycan degradation	map00511

Gene Ontology

GO term	Ontology	Name
GO:0004553	molecular_function	hydrolase activity, hydrolyzing O-glycosyl compounds

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.782
	SRR3591706	second leaf	1.876
	SRR3591707	mature leaf	1.691
	SRR3591708	Shoot apex	1.090
	SRR3591709	Stem	2.030
	SRR3591710	White floral bud	3.368
	SRR3591711	White flower	3.447
	SRR3591712	Green floral bud	2.202
	SRR3591713	Yellow flower	3.952
SRP173429	SRR8316895	Juvenile bud stage	1.378
	SRR8316896	Juvenile bud stage	3.133
	SRR8316897	Juvenile bud stage	1.360
	SRR8316894	Third green stage	1.349
	SRR8316900	Third green stage	4.105
	SRR8316901	Third green stage	3.866
	SRR8316898	Complete white stage	2.516
	SRR8316899	Complete white stage	5.784
	SRR8316903	Complete white stage	4.902
	SRR8316902	Silver flowering stage	2.385
	SRR8316904	Silver flowering stage	4.030
	SRR8316905	Silver flowering stage	1.969
	SRR8316906	Gold flowering stage	7.066
	SRR8316907	Gold flowering stage	6.334
	SRR8316908	Gold flowering stage	5.703
SRP132670	SRR6706286	Control	2.165
	SRR6706287	Light intensity 50%	2.624
	SRR6706288	Light intensity 20%	2.512
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.313
	CNS0095593	Slightly white alabastrum(diploid) 2	0.913
	CNS0095594	Slightly white alabastrum(diploid) 3	0.432
	CNS0095595	Whole white alabastrum(diploid) 2	2.230
	CNS0095596	Whole white alabastrum(diploid) 3	1.044
	CNS0095597	Whole white alabastrum(diploid) 4	1.047
	CNS0095598	Silvery flower (diploied) 1	2.594
	CNS0095599	Silvery flower (diploied) 2	3.102
	CNS0095600	Silvery flower (diploied) 3	5.434
	CNS0095601	Golden flower (diploid) 1	1.615
	CNS0095602	Golden flower (diploid) 2	4.796
	CNS0095603	Golden flower (diploid) 3	4.182
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.568
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.890
	CNS0095606	Slightly white alabastrum(tetraploid) 3	5.720
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.238
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.352
	CNS0095609	Whole white alabastrum(tetraploid) 3	5.158
	CNS0095610	Silvery flower (tetraploid) 1	5.784
	CNS0095611	Silvery flower (tetraploid) 2	4.911
	CNS0095612	Silvery flower (tetraploid) 3	6.272
	CNS0095613	Golden flower (tetraploid) 1	1.738
	CNS0095614	Golden flower (tetraploid) 2	3.988
	CNS0095615	Golden flower (tetraploid) 3	3.284
CRA001975	CRR073297	Stem 1	1.703
	CRR073298	Stem 2	1.886
	CRR073299	Stem 3	1.090
	CRR073300	Leaf 1	2.992
	CRR073301	Leaf 2	3.051
	CRR073302	Leaf 3	1.807
	CRR073303	Juvenile bud 1	0.686
	CRR073304	Juvenile bud 2	2.336
	CRR073305	Juvenile bud 3	2.967
	CRR073306	Third green 1	1.433
	CRR073307	Third green 2	0.979
	CRR073308	Third green 3	1.548
	CRR073309	Second white 1	4.000
	CRR073310	Second white 2	2.949
	CRR073311	Second white 3	3.177
	CRR073312	Silver flowering 1	3.642
	CRR073313	Silver flowering 2	1.365
	CRR073314	Silver flowering 3	1.843
	CRR073315	Gold flowering 1	1.130
	CRR073316	Gold flowering 2	3.711
	CRR073317	Gold flowering 3	2.503
	CRR073318	Tawny withering 1	2.994
	CRR073319	Tawny withering 2	2.191
	CRR073320	Tawny withering 3	0.587