Gene detail

Detail information of GWHGAAZE029418

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP18233.1	2.9603E-135	unnamed protein product [Coffea canephora]
COG	YP_001737337.1	7E-20	small GTP-binding protein
Swissprot	tr\|O04834\|SAR1A_ARATH	1E-134	GTP-binding protein SAR1A
trEMBL	tr\|A0A068VEY1\|A0A068VEY1_COFCA	1E-135	Coffea canephora DH200=94 genomic scaffold, scaffold_219 {ECO:0000313\|EMBL:CDP18233.1}
TAIR10	AT4G02080.1	4E-86	secretion-associated RAS super family 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	21884135	21889072	+
GWHAAZE00000009	mRNA	21884135	21889072	+
GWHAAZE00000009	exon	21884135	21884263	+
GWHAAZE00000009	exon	21885403	21885534	+
GWHAAZE00000009	exon	21888752	21889072	+
GWHAAZE00000009	CDS	21884135	21884263	+
GWHAAZE00000009	CDS	21885403	21885534	+
GWHAAZE00000009	CDS	21888752	21889072	+

Transcript Sequence
>GWHTAAZE029452 ATGTTTTTGCTGGATTGGTTCTATGGAGTTCTCGCATCGCTAGGTCTTTGGCAGAAAGAGGCGAAGATCTTGTTCTTAGGGCTCGATAATGCCGGTAAAACGACGTTGCTTCATATGTTGAAAGACGAGAGATTGGTTCAACACCAGCCAACTCAGTATCCAACATCCGAGGAGCTGAGTATTGGGAAAATCAAGTTCAAGGCTTTTGATTTGGGAGGCCATCAGATTGCCCGTAGAGTTTGGAAAGATTACTACGCCAAGGTGGATGCGGTGGTTTACCTGGTGGACGCATACGACAAGGAGAGGTTTGCCGAGTCCAAGAAAGAGCTAGACGCGCTACTCTCAGATGAGTCATTGGCAAACGTGCCGTTTCTGATACTGGGCAACAAGATCGACATCCCTTATGCTGCCTCGGAAGACGAGCTACGTTACAACATGGGTCTGACCGGACTGACCACGGGCAAGGGCAAGGTCAACCTTACCGACTCAGCAGTTCGACCACTCGAGGTATTCATGTGCAGCATCGTCCGCAAAATGGGCTACGGCGAGGGCTTCAAGTGGCTCTCTCAATACATCAAGTAG

Network for GWHGAAZE029418

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00025.22	Arf	8	192	2.10E-65

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07953	SAR1	Protein processing in endoplasmic reticulum	map04141

Gene Ontology

GO term	Ontology	Name
GO:0006886	biological_process	intracellular protein transport
GO:0005525	molecular_function	GTP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	72.994
	SRR3591706	second leaf	47.612
	SRR3591707	mature leaf	18.788
	SRR3591708	Shoot apex	61.591
	SRR3591709	Stem	40.837
	SRR3591710	White floral bud	44.765
	SRR3591711	White flower	35.440
	SRR3591712	Green floral bud	70.261
	SRR3591713	Yellow flower	25.008
SRP173429	SRR8316895	Juvenile bud stage	63.892
	SRR8316896	Juvenile bud stage	95.699
	SRR8316897	Juvenile bud stage	48.225
	SRR8316894	Third green stage	36.749
	SRR8316900	Third green stage	104.343
	SRR8316901	Third green stage	107.703
	SRR8316898	Complete white stage	40.232
	SRR8316899	Complete white stage	86.250
	SRR8316903	Complete white stage	68.235
	SRR8316902	Silver flowering stage	52.389
	SRR8316904	Silver flowering stage	39.018
	SRR8316905	Silver flowering stage	8.946
	SRR8316906	Gold flowering stage	32.302
	SRR8316907	Gold flowering stage	38.981
	SRR8316908	Gold flowering stage	47.129
SRP132670	SRR6706286	Control	77.203
	SRR6706287	Light intensity 50%	81.972
	SRR6706288	Light intensity 20%	87.706
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	105.250
	CNS0095593	Slightly white alabastrum(diploid) 2	116.193
	CNS0095594	Slightly white alabastrum(diploid) 3	113.480
	CNS0095595	Whole white alabastrum(diploid) 2	84.013
	CNS0095596	Whole white alabastrum(diploid) 3	94.445
	CNS0095597	Whole white alabastrum(diploid) 4	74.292
	CNS0095598	Silvery flower (diploied) 1	49.320
	CNS0095599	Silvery flower (diploied) 2	44.509
	CNS0095600	Silvery flower (diploied) 3	31.030
	CNS0095601	Golden flower (diploid) 1	31.737
	CNS0095602	Golden flower (diploid) 2	31.589
	CNS0095603	Golden flower (diploid) 3	30.382
	CNS0095604	Slightly white alabastrum(tetraploid) 1	108.906
	CNS0095605	Slightly white alabastrum(tetraploid) 2	106.313
	CNS0095606	Slightly white alabastrum(tetraploid) 3	102.185
	CNS0095607	Whole white alabastrum(tetraploid) 1	78.583
	CNS0095608	Whole white alabastrum(tetraploid) 2	70.738
	CNS0095609	Whole white alabastrum(tetraploid) 3	69.080
	CNS0095610	Silvery flower (tetraploid) 1	36.790
	CNS0095611	Silvery flower (tetraploid) 2	24.144
	CNS0095612	Silvery flower (tetraploid) 3	24.196
	CNS0095613	Golden flower (tetraploid) 1	24.324
	CNS0095614	Golden flower (tetraploid) 2	23.323
	CNS0095615	Golden flower (tetraploid) 3	20.479
CRA001975	CRR073297	Stem 1	82.063
	CRR073298	Stem 2	80.079
	CRR073299	Stem 3	100.475
	CRR073300	Leaf 1	86.198
	CRR073301	Leaf 2	96.518
	CRR073302	Leaf 3	103.359
	CRR073303	Juvenile bud 1	83.358
	CRR073304	Juvenile bud 2	59.149
	CRR073305	Juvenile bud 3	60.624
	CRR073306	Third green 1	20.977
	CRR073307	Third green 2	29.156
	CRR073308	Third green 3	28.060
	CRR073309	Second white 1	16.255
	CRR073310	Second white 2	17.622
	CRR073311	Second white 3	10.688
	CRR073312	Silver flowering 1	16.617
	CRR073313	Silver flowering 2	14.069
	CRR073314	Silver flowering 3	17.759
	CRR073315	Gold flowering 1	35.174
	CRR073316	Gold flowering 2	33.336
	CRR073317	Gold flowering 3	33.476
	CRR073318	Tawny withering 1	66.592
	CRR073319	Tawny withering 2	57.349
	CRR073320	Tawny withering 3	62.852