Gene detail

Detail information of GWHGAAZE029383

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDP28732.1	2.38416E-81	hypothetical protein JCGZ_14503 [Jatropha curcas]
COG	YP_003335910.1	1E-20	protein kinase
Swissprot	tr\|O64629\|AUR3_ARATH	3E-69	Serine/threonine-protein kinase Aurora-3
trEMBL	tr\|A0A067JY03\|A0A067JY03_JATCU	9E-82	Uncharacterized protein {ECO:0000313\|EMBL:KDP28732.1}
TAIR10	AT2G45490.1	1E-56	ataurora3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	20918428	20920933	-
GWHAAZE00000009	mRNA	20918428	20920933	-
GWHAAZE00000009	exon	20918428	20918467	-
GWHAAZE00000009	exon	20918558	20918772	-
GWHAAZE00000009	exon	20919450	20919545	-
GWHAAZE00000009	exon	20920493	20920540	-
GWHAAZE00000009	exon	20920814	20920933	-
GWHAAZE00000009	CDS	20920814	20920933	-
GWHAAZE00000009	CDS	20920493	20920540	-
GWHAAZE00000009	CDS	20919450	20919545	-
GWHAAZE00000009	CDS	20918558	20918772	-
GWHAAZE00000009	CDS	20918428	20918467	-

Transcript Sequence
>GWHTAAZE029417 ATGGCATCCAAAACTGAAAAACAAAACCCTAAAAAACAATGGTCCTTAAAAGACTTTGAGATCGGAAAGCCCTTCGGCAAGGGCAAATTCGGACGTGTCTACCTCGCCCGTGAAATCAAGAGCCAGTACATAGTGGCATTAAAGGTGATATTCAAAGAGCAAATAGAATACATATCAAGCTTAGCACAAGCGTTGGCATATTGTCACGAGAAGGGTGTGATTCATAGGGATATCAAGCCAAAAAACTTGTTACTTGATCACGAGGGTGTATTGAAGATTGAGGATTTTGGATGGTCGGTCCAATCGAGAAGCAAGAGACACACCATGTGTGGAACTTTGGACTATTTAGCACCAGAAATGGTGGAGAACAAAGCTCATGATTATGCCGTTGATAATTGGACATTGGGTATCCTTTGTTATGAGTTTTTGTATGGCATCCCTCCATTTGAGGCAGAGAGCCAAGTAGATACATTCAAAAGGATTATGAAGATTGACCTGAATTTTCCTTCCACCCCTTAA

Network for GWHGAAZE029383

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	56	162	2.30E-35

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	Aur

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.277
	SRR3591706	second leaf	1.597
	SRR3591707	mature leaf	0.931
	SRR3591708	Shoot apex	3.964
	SRR3591709	Stem	3.358
	SRR3591710	White floral bud	3.251
	SRR3591711	White flower	2.280
	SRR3591712	Green floral bud	3.732
	SRR3591713	Yellow flower	2.691
SRP173429	SRR8316895	Juvenile bud stage	0.913
	SRR8316896	Juvenile bud stage	1.296
	SRR8316897	Juvenile bud stage	1.525
	SRR8316894	Third green stage	0.888
	SRR8316900	Third green stage	2.265
	SRR8316901	Third green stage	1.818
	SRR8316898	Complete white stage	0.728
	SRR8316899	Complete white stage	1.761
	SRR8316903	Complete white stage	1.018
	SRR8316902	Silver flowering stage	0.915
	SRR8316904	Silver flowering stage	1.774
	SRR8316905	Silver flowering stage	0.271
	SRR8316906	Gold flowering stage	1.850
	SRR8316907	Gold flowering stage	1.534
	SRR8316908	Gold flowering stage	2.500
SRP132670	SRR6706286	Control	1.533
	SRR6706287	Light intensity 50%	1.864
	SRR6706288	Light intensity 20%	1.689
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.100
	CNS0095593	Slightly white alabastrum(diploid) 2	0.786
	CNS0095594	Slightly white alabastrum(diploid) 3	0.961
	CNS0095595	Whole white alabastrum(diploid) 2	1.838
	CNS0095596	Whole white alabastrum(diploid) 3	1.281
	CNS0095597	Whole white alabastrum(diploid) 4	1.198
	CNS0095598	Silvery flower (diploied) 1	2.006
	CNS0095599	Silvery flower (diploied) 2	1.437
	CNS0095600	Silvery flower (diploied) 3	2.574
	CNS0095601	Golden flower (diploid) 1	1.181
	CNS0095602	Golden flower (diploid) 2	1.623
	CNS0095603	Golden flower (diploid) 3	1.665
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.646
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.032
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.826
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.401
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.477
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.866
	CNS0095610	Silvery flower (tetraploid) 1	1.611
	CNS0095611	Silvery flower (tetraploid) 2	1.975
	CNS0095612	Silvery flower (tetraploid) 3	1.818
	CNS0095613	Golden flower (tetraploid) 1	1.287
	CNS0095614	Golden flower (tetraploid) 2	1.394
	CNS0095615	Golden flower (tetraploid) 3	1.310
CRA001975	CRR073297	Stem 1	4.275
	CRR073298	Stem 2	4.037
	CRR073299	Stem 3	4.099
	CRR073300	Leaf 1	3.779
	CRR073301	Leaf 2	3.777
	CRR073302	Leaf 3	3.160
	CRR073303	Juvenile bud 1	1.912
	CRR073304	Juvenile bud 2	3.416
	CRR073305	Juvenile bud 3	2.340
	CRR073306	Third green 1	1.641
	CRR073307	Third green 2	2.223
	CRR073308	Third green 3	2.464
	CRR073309	Second white 1	1.177
	CRR073310	Second white 2	1.575
	CRR073311	Second white 3	3.321
	CRR073312	Silver flowering 1	2.211
	CRR073313	Silver flowering 2	1.635
	CRR073314	Silver flowering 3	0.812
	CRR073315	Gold flowering 1	2.233
	CRR073316	Gold flowering 2	2.237
	CRR073317	Gold flowering 3	1.430
	CRR073318	Tawny withering 1	2.739
	CRR073319	Tawny withering 2	2.428
	CRR073320	Tawny withering 3	3.608