Gene detail

Detail information of GWHGAAZE029154

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008340474.1	1.65236E-75	PREDICTED: uracil-DNA glycosylase isoform X2 [Malus domestica]
COG	YP_003122406.1	6E-39	uracil-DNA glycosylase
trEMBL	tr\|A0A061E9U8\|A0A061E9U8_THECC	2E-73	Uracil-DNA glycosylase {ECO:0000256\|HAMAP-Rule:MF_03166}
TAIR10	AT3G18630.1	7E-53	uracil dna glycosylase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	8840365	8841171	+
GWHAAZE00000009	mRNA	8840365	8841171	+
GWHAAZE00000009	exon	8840365	8840739	+
GWHAAZE00000009	exon	8840854	8840921	+
GWHAAZE00000009	exon	8841021	8841171	+
GWHAAZE00000009	CDS	8840365	8840739	+
GWHAAZE00000009	CDS	8840854	8840921	+
GWHAAZE00000009	CDS	8841021	8841171	+

Transcript Sequence
>GWHTAAZE029188 ATGATATCATTGAATAGGCGATCAAGAACAACAGGCTATGCAAAGAAGTTGCCACCAAATCATCCCTTCTCACATTTGTCTGCCACAGTTGAGGGGGTTTTGCCTTTGAATTTAAAATTGGAAGAGCTATTGGTGGAGCAGATGTGGTTGGAAGCACTTCCGGGGGAACTCCATAAGCCCTACGCAAAGAAGTTGTGCAATTTCGTTGAAAGTGAAATAAGAGGTGGCTGTGATGGTACTGGAGTTCCAATTTATCCGCCCCCGCATTTGATCTTCAATGCACTTAACACTACATCATTTGACAGGGTCAAAGCTGTCATCATCGGGCAGGATCCGTGTCATGGGCCTGGTCAAGGAATGGGCCTTTCTTTTTCTGGTGTTCTATTGCTCAATGCTGTTCTTACTGTTAGGAAGCATCAGGCAAATTCTCACGCAAAGAAGAGGTTGATTGATGAGACAAAGCACCACATTCTCAAGGCAGCACACCCTTCTGGTTTATCTGAAAATAGAGGCTTCTTTAAATGCAGGCATTTTTCACGCACAAACCAGATCCTGGCTGAAATGGGAGTTTCTCCAATAGATTGGCAGCTATAA

Network for GWHGAAZE029154

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03648	UNG, UDG	Base excision repair	map03410

Gene Ontology

GO term	Ontology	Name
GO:0006281	biological_process	DNA repair
GO:0006284	biological_process	base-excision repair
GO:0004844	molecular_function	uracil DNA N-glycosylase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.080
	SRR3591706	second leaf	0.141
	SRR3591707	mature leaf	0.562
	SRR3591708	Shoot apex	1.722
	SRR3591709	Stem	1.127
	SRR3591710	White floral bud	0.555
	SRR3591711	White flower	0.975
	SRR3591712	Green floral bud	0.836
	SRR3591713	Yellow flower	0.694
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.037
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.157
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.010
	SRR8316907	Gold flowering stage	0.024
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.003
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.011
	CNS0095595	Whole white alabastrum(diploid) 2	0.014
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.009
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.023
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.042
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.025
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.011
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.019
	CNS0095612	Silvery flower (tetraploid) 3	0.007
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.012
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.010
	CRR073298	Stem 2	0.023
	CRR073299	Stem 3	0.010
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.011
	CRR073302	Leaf 3	0.010
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.008
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.012
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.008
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.073
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000