Gene detail

Detail information of GWHGAAZE029084

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AFD93403.1	1.01026E-52	Ras-like GTP-binding protein 1 [Dimocarpus longan]
Swissprot	tr\|Q8H156\|RAN3_ARATH	3E-54	GTP-binding nuclear protein Ran-3
trEMBL	tr\|H9EJY8\|H9EJY8_9ROSI	4E-53	Ras-like GTP-binding protein 1 {ECO:0000313\|EMBL:AFD93403.1}
TAIR10	AT5G55190.1	1E-43	RAN GTPase 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	5943895	5945210	-
GWHAAZE00000009	mRNA	5943895	5945210	-
GWHAAZE00000009	exon	5945194	5945210	-
GWHAAZE00000009	exon	5944078	5944257	-
GWHAAZE00000009	exon	5943895	5943967	-
GWHAAZE00000009	CDS	5945194	5945210	-
GWHAAZE00000009	CDS	5944078	5944257	-
GWHAAZE00000009	CDS	5943895	5943967	-

Transcript Sequence
>GWHTAAZE029118 ATGATCTTGGTAATCAGGGTATGTGAGAATATCCCAATTGTTTTTTGTGGGAACAAGGTTGATGTCAAGAATAGGCAGGTGAAAGCAAAGCAGGTCACATTCCATAGAAAGAAGAACCTTCAATATTACGAGATTTCTGCCAAGAGCAACTACAACTTTGAGAAACCATTCCTGTATCTTGCTAGGAAACTAGCTGGGGATGCTAATCTTCACTTTGTTGAGTCACCGGCCCTTGCTCCTCCAGAGGTTCAAATTGACATGGCTCAATAA

Network for GWHGAAZE029084

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00071.23	Ras	5	64	1.60E-12

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07936	RAN	RNA transport	map03013
K07936	RAN	Ribosome biogenesis in eukaryotes	map03008

Gene Ontology

GO term	Ontology	Name
GO:0006913	biological_process	nucleocytoplasmic transport
GO:0003924	molecular_function	GTPase activity
GO:0005525	molecular_function	GTP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	56.586
	SRR3591706	second leaf	24.764
	SRR3591707	mature leaf	39.687
	SRR3591708	Shoot apex	56.825
	SRR3591709	Stem	72.852
	SRR3591710	White floral bud	39.159
	SRR3591711	White flower	93.234
	SRR3591712	Green floral bud	43.101
	SRR3591713	Yellow flower	49.125
SRP173429	SRR8316895	Juvenile bud stage	19.164
	SRR8316896	Juvenile bud stage	23.045
	SRR8316897	Juvenile bud stage	2.053
	SRR8316894	Third green stage	7.263
	SRR8316900	Third green stage	26.583
	SRR8316901	Third green stage	23.240
	SRR8316898	Complete white stage	7.453
	SRR8316899	Complete white stage	31.018
	SRR8316903	Complete white stage	14.055
	SRR8316902	Silver flowering stage	36.705
	SRR8316904	Silver flowering stage	27.298
	SRR8316905	Silver flowering stage	6.791
	SRR8316906	Gold flowering stage	17.832
	SRR8316907	Gold flowering stage	17.094
	SRR8316908	Gold flowering stage	7.219
SRP132670	SRR6706286	Control	3.682
	SRR6706287	Light intensity 50%	3.565
	SRR6706288	Light intensity 20%	5.297
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	19.498
	CNS0095593	Slightly white alabastrum(diploid) 2	24.883
	CNS0095594	Slightly white alabastrum(diploid) 3	17.102
	CNS0095595	Whole white alabastrum(diploid) 2	17.928
	CNS0095596	Whole white alabastrum(diploid) 3	15.469
	CNS0095597	Whole white alabastrum(diploid) 4	3.756
	CNS0095598	Silvery flower (diploied) 1	16.217
	CNS0095599	Silvery flower (diploied) 2	12.524
	CNS0095600	Silvery flower (diploied) 3	15.791
	CNS0095601	Golden flower (diploid) 1	16.778
	CNS0095602	Golden flower (diploid) 2	15.269
	CNS0095603	Golden flower (diploid) 3	15.561
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.931
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.556
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.798
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.159
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.603
	CNS0095609	Whole white alabastrum(tetraploid) 3	3.452
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.063
	CNS0095613	Golden flower (tetraploid) 1	0.260
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	16.684
	CRR073298	Stem 2	14.102
	CRR073299	Stem 3	6.325
	CRR073300	Leaf 1	14.326
	CRR073301	Leaf 2	18.025
	CRR073302	Leaf 3	22.567
	CRR073303	Juvenile bud 1	13.871
	CRR073304	Juvenile bud 2	11.229
	CRR073305	Juvenile bud 3	11.863
	CRR073306	Third green 1	6.368
	CRR073307	Third green 2	10.271
	CRR073308	Third green 3	9.128
	CRR073309	Second white 1	16.607
	CRR073310	Second white 2	11.210
	CRR073311	Second white 3	9.577
	CRR073312	Silver flowering 1	9.395
	CRR073313	Silver flowering 2	11.749
	CRR073314	Silver flowering 3	8.133
	CRR073315	Gold flowering 1	29.736
	CRR073316	Gold flowering 2	23.735
	CRR073317	Gold flowering 3	25.388
	CRR073318	Tawny withering 1	35.529
	CRR073319	Tawny withering 2	39.070
	CRR073320	Tawny withering 3	27.154