Gene detail

Detail information of GWHGAAZE029075

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AFD93403.1	1.0267E-51	Ras-like GTP-binding protein 1 [Dimocarpus longan]
Swissprot	tr\|P41919\|RANB1_TOBAC	4E-53	GTP-binding nuclear protein Ran-B1
trEMBL	tr\|H9EJY8\|H9EJY8_9ROSI	4E-52	Ras-like GTP-binding protein 1 {ECO:0000313\|EMBL:AFD93403.1}
TAIR10	AT5G55190.1	1E-42	RAN GTPase 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	5349673	5350030	+
GWHAAZE00000009	mRNA	5349673	5350030	+
GWHAAZE00000009	exon	5349673	5349851	+
GWHAAZE00000009	exon	5349958	5350030	+
GWHAAZE00000009	CDS	5349673	5349851	+
GWHAAZE00000009	CDS	5349958	5350030	+

Transcript Sequence
>GWHTAAZE029109 GTATGTGAGAATATCCCAATTGTTTTTTGTGGGAACAAGGTTGATGTCAAGAATAGGCAGGTGAAAGCAAAGCAGGTCACATTCCATAGAAAGAAGAACCTTCAATATTACGAGATTTCTGCCAAGAGCAACTACAACTTTGAGAAACCATTCCTGTATCTTGCTAGGAAACTAGCTGGGGATGCTAATCTTCACTTTGTTGAGTCACCGGCCCTTGCTCCTCCAGAGGTTCAAATTGACATGGCTCAATAA

Network for GWHGAAZE029075

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00071.23	Ras	3	58	4.90E-12

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07936	RAN	RNA transport	map03013
K07936	RAN	Ribosome biogenesis in eukaryotes	map03008

Gene Ontology

GO term	Ontology	Name
GO:0006913	biological_process	nucleocytoplasmic transport
GO:0003924	molecular_function	GTPase activity
GO:0005525	molecular_function	GTP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	78.810
	SRR3591706	second leaf	36.886
	SRR3591707	mature leaf	50.683
	SRR3591708	Shoot apex	76.994
	SRR3591709	Stem	102.402
	SRR3591710	White floral bud	58.165
	SRR3591711	White flower	139.611
	SRR3591712	Green floral bud	64.244
	SRR3591713	Yellow flower	58.208
SRP173429	SRR8316895	Juvenile bud stage	32.707
	SRR8316896	Juvenile bud stage	40.444
	SRR8316897	Juvenile bud stage	2.278
	SRR8316894	Third green stage	11.546
	SRR8316900	Third green stage	39.978
	SRR8316901	Third green stage	44.016
	SRR8316898	Complete white stage	13.483
	SRR8316899	Complete white stage	53.695
	SRR8316903	Complete white stage	19.390
	SRR8316902	Silver flowering stage	52.063
	SRR8316904	Silver flowering stage	35.663
	SRR8316905	Silver flowering stage	11.255
	SRR8316906	Gold flowering stage	35.406
	SRR8316907	Gold flowering stage	34.682
	SRR8316908	Gold flowering stage	12.200
SRP132670	SRR6706286	Control	7.651
	SRR6706287	Light intensity 50%	9.736
	SRR6706288	Light intensity 20%	10.092
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	35.605
	CNS0095593	Slightly white alabastrum(diploid) 2	37.896
	CNS0095594	Slightly white alabastrum(diploid) 3	34.784
	CNS0095595	Whole white alabastrum(diploid) 2	28.342
	CNS0095596	Whole white alabastrum(diploid) 3	23.976
	CNS0095597	Whole white alabastrum(diploid) 4	29.796
	CNS0095598	Silvery flower (diploied) 1	34.465
	CNS0095599	Silvery flower (diploied) 2	27.786
	CNS0095600	Silvery flower (diploied) 3	42.441
	CNS0095601	Golden flower (diploid) 1	27.135
	CNS0095602	Golden flower (diploid) 2	32.893
	CNS0095603	Golden flower (diploid) 3	29.162
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.290
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.582
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.855
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.823
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.270
	CNS0095609	Whole white alabastrum(tetraploid) 3	3.270
	CNS0095610	Silvery flower (tetraploid) 1	1.018
	CNS0095611	Silvery flower (tetraploid) 2	1.009
	CNS0095612	Silvery flower (tetraploid) 3	0.068
	CNS0095613	Golden flower (tetraploid) 1	0.278
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	45.194
	CRR073298	Stem 2	41.668
	CRR073299	Stem 3	55.868
	CRR073300	Leaf 1	32.122
	CRR073301	Leaf 2	45.193
	CRR073302	Leaf 3	57.190
	CRR073303	Juvenile bud 1	43.918
	CRR073304	Juvenile bud 2	27.431
	CRR073305	Juvenile bud 3	51.665
	CRR073306	Third green 1	16.035
	CRR073307	Third green 2	19.471
	CRR073308	Third green 3	27.382
	CRR073309	Second white 1	26.005
	CRR073310	Second white 2	26.344
	CRR073311	Second white 3	18.009
	CRR073312	Silver flowering 1	18.943
	CRR073313	Silver flowering 2	24.550
	CRR073314	Silver flowering 3	19.943
	CRR073315	Gold flowering 1	60.554
	CRR073316	Gold flowering 2	55.019
	CRR073317	Gold flowering 3	48.541
	CRR073318	Tawny withering 1	66.626
	CRR073319	Tawny withering 2	86.254
	CRR073320	Tawny withering 3	72.020