Gene detail

Detail information of GWHGAAZE028988

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009376335.1	3.1293E-121	PREDICTED: glucan endo-1,3-beta-glucosidase 6 [Pyrus x bretschneideri]
Swissprot	tr\|Q93Z08\|E136_ARATH	7E-114	Glucan endo-1,3-beta-glucosidase 6 (Precursor)
trEMBL	tr\|A0A067GDD2\|A0A067GDD2_CITSI	2E-118	Uncharacterized protein {ECO:0000313\|EMBL:KDO73371.1}
TAIR10	AT5G58090.1	2E-93	O-Glycosyl hydrolases family 17 protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	878014	883410	+
GWHAAZE00000009	mRNA	878014	883410	+
GWHAAZE00000009	exon	878014	878411	+
GWHAAZE00000009	exon	883062	883410	+
GWHAAZE00000009	CDS	878014	878411	+
GWHAAZE00000009	CDS	883062	883410	+

Transcript Sequence
>GWHTAAZE029022 ATGAGAATCAATAATCGTGATATAGAGCAGAGGCCAGAGGTTATAGATTTGATGGGGTTTGTTTCAGTTAGAGTACTAATAGTGGTTTTGACACTAGTTGTTTTAGCATCATGGGGTGAGTTAGTGGGTGGGCTTGGTGCTAATTGGGGAACACAGGCATCCCACCCGCTGCCGCCAGAGACGGTGGTTAGGCTATTGAAAGAAAATGGGATTCAAAAAGTGAAGCTATTTGATGCGGATTACGGGGCTTTGAGAGCTCTAAGTAAGTCTGAGATTGAGGTTATGGTTGGGATTCCAAATGATATGCTCGCAACCTTGGCTAGCAGTATGAAGGCTGCCGAGAAATGGGTTTCTAAAAATATATCTGCTCATATGTCTAACAATAATGTCAACATCAGGTATGTTGCAGTTGGGAATGAACCATTTTTGTCAACTTATAATGGAACCTTTCTGAGAACAACGCTCCCTGCTCTCCGAAACATCCAATCCGCCCTCATAAAAGCTGGGCTTAGCAACCGAGTAAAGGTCACTTGCCCACAAAATGCTGACGTATATGAGAGCTCTAGTACCCTTCCTTCTGGTGGCGATTTCCGAGCTGACATCCACGATTACATGATACAAATCGTCAAGTTCCTTAACGACAACGGTGCACCCTTCACCGCCAACATCTACCCATTTATTAGCCTCTACATCGACCCAAATTTCCCAGCTGACTATGCCTTCTTTGATGGTAACTCGCCCCTATAA

Network for GWHGAAZE028988

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00332.19	Glyco_hydro_17	45	246	2.80E-35

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K19893	GN5_6	Metabolic pathways	map01100
K19893	GN5_6	Starch and sucrose metabolism	map00500

Gene Ontology

GO term	Ontology	Name
GO:0005975	biological_process	carbohydrate metabolic process
GO:0004553	molecular_function	hydrolase activity, hydrolyzing O-glycosyl compounds

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.916
	SRR3591706	second leaf	2.228
	SRR3591707	mature leaf	1.176
	SRR3591708	Shoot apex	6.394
	SRR3591709	Stem	3.110
	SRR3591710	White floral bud	1.945
	SRR3591711	White flower	0.412
	SRR3591712	Green floral bud	3.819
	SRR3591713	Yellow flower	0.651
SRP173429	SRR8316895	Juvenile bud stage	1.570
	SRR8316896	Juvenile bud stage	1.014
	SRR8316897	Juvenile bud stage	0.900
	SRR8316894	Third green stage	0.876
	SRR8316900	Third green stage	2.266
	SRR8316901	Third green stage	1.961
	SRR8316898	Complete white stage	0.373
	SRR8316899	Complete white stage	2.585
	SRR8316903	Complete white stage	1.470
	SRR8316902	Silver flowering stage	0.207
	SRR8316904	Silver flowering stage	0.277
	SRR8316905	Silver flowering stage	0.085
	SRR8316906	Gold flowering stage	0.301
	SRR8316907	Gold flowering stage	0.181
	SRR8316908	Gold flowering stage	0.376
SRP132670	SRR6706286	Control	0.684
	SRR6706287	Light intensity 50%	0.490
	SRR6706288	Light intensity 20%	0.590
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.369
	CNS0095593	Slightly white alabastrum(diploid) 2	1.815
	CNS0095594	Slightly white alabastrum(diploid) 3	0.829
	CNS0095595	Whole white alabastrum(diploid) 2	0.873
	CNS0095596	Whole white alabastrum(diploid) 3	0.547
	CNS0095597	Whole white alabastrum(diploid) 4	0.931
	CNS0095598	Silvery flower (diploied) 1	1.854
	CNS0095599	Silvery flower (diploied) 2	0.968
	CNS0095600	Silvery flower (diploied) 3	0.843
	CNS0095601	Golden flower (diploid) 1	1.421
	CNS0095602	Golden flower (diploid) 2	1.777
	CNS0095603	Golden flower (diploid) 3	2.170
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.291
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.344
	CNS0095606	Slightly white alabastrum(tetraploid) 3	5.933
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.917
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.891
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.336
	CNS0095610	Silvery flower (tetraploid) 1	0.426
	CNS0095611	Silvery flower (tetraploid) 2	0.779
	CNS0095612	Silvery flower (tetraploid) 3	0.779
	CNS0095613	Golden flower (tetraploid) 1	0.278
	CNS0095614	Golden flower (tetraploid) 2	1.027
	CNS0095615	Golden flower (tetraploid) 3	0.843
CRA001975	CRR073297	Stem 1	2.154
	CRR073298	Stem 2	4.081
	CRR073299	Stem 3	2.568
	CRR073300	Leaf 1	4.189
	CRR073301	Leaf 2	4.643
	CRR073302	Leaf 3	2.014
	CRR073303	Juvenile bud 1	1.484
	CRR073304	Juvenile bud 2	2.648
	CRR073305	Juvenile bud 3	4.595
	CRR073306	Third green 1	0.441
	CRR073307	Third green 2	0.082
	CRR073308	Third green 3	0.370
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.097
	CRR073311	Second white 3	0.176
	CRR073312	Silver flowering 1	0.102
	CRR073313	Silver flowering 2	0.218
	CRR073314	Silver flowering 3	0.187
	CRR073315	Gold flowering 1	0.924
	CRR073316	Gold flowering 2	1.263
	CRR073317	Gold flowering 3	0.746
	CRR073318	Tawny withering 1	1.220
	CRR073319	Tawny withering 2	2.712
	CRR073320	Tawny withering 3	1.971