Gene detail

Detail information of GWHGAAZE028976

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	BAO02528.1	3.33811E-92	predicted receptor-like protein kinase ortholog, partial [Nicotiana alata]
Swissprot	tr\|C0LGR9\|Y4312_ARATH	2E-66	Probable LRR receptor-like serine/threonine-protein kinase At4g31250 (Precursor)
trEMBL	tr\|U6C0V5\|U6C0V5_NICAL	1E-92	Predicted receptor-like protein kinase ortholog {ECO:0000313\|EMBL:BAO02528.1} (Fragment)
TAIR10	AT4G31250.1	2E-57	Leucine-rich repeat protein kinase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	574164	574985	+
GWHAAZE00000009	mRNA	574164	574985	+
GWHAAZE00000009	exon	574164	574278	+
GWHAAZE00000009	exon	574404	574466	+
GWHAAZE00000009	exon	574573	574985	+
GWHAAZE00000009	CDS	574164	574278	+
GWHAAZE00000009	CDS	574404	574466	+
GWHAAZE00000009	CDS	574573	574985	+

Transcript Sequence
>GWHTAAZE029010 ATGAACAATGTCGGAAAAGAGGATTTTCAAGAGCATATGAGAAGGTTGGGAAGATTGAGACATCCCAACTTACTTCCGCTTGTCGCCTTCTACTACAGAAAAGAAGAAACTCTTGGTAATCGCCAACCAGGACTTGATTGGGCTGCACGGTTAAAAATTGTGAAGGGAGTAATTAAAGATTATGGATTAGTTCCAATTATCAACCAAGAACATGCGCAAGAGCTAATGGTTGCATATAAGTCGCCAGAATACAAGCAAACCTGGCGCATAACAAAGAAAACAGACGTTTGGAGTTTAGGGACATTGATACTAGAGATTTTAACAGGGAAATTCCCGGCTAACTCTTTACACCAAGGTAAAATAGGTGACACAGATTTGGCAACATGGGCACAATCTTTGGTTCGGGAAGATTTCACTAATATGGAAGTGTTTGATAAAGATATCAGAGGAACCAAAAATAGCGAAGGTGAGATGATGAAACTTCTAAAGATAGGTTTGTCTTGTTGTGAAATTGATGTGGAGAAAAGGTTGGACATGAAGGAGGTTGCCGAAAAGATCGAAGAGTTGAGAGAGAAAGATAGCGAGAGATAA

Network for GWHGAAZE028976

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	58	184	1.70E-10

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_LRR-III

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.192
	SRR3591710	White floral bud	79.129
	SRR3591711	White flower	3.831
	SRR3591712	Green floral bud	45.596
	SRR3591713	Yellow flower	1.769
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.149
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.621
	SRR8316900	Third green stage	18.202
	SRR8316901	Third green stage	13.252
	SRR8316898	Complete white stage	0.071
	SRR8316899	Complete white stage	0.307
	SRR8316903	Complete white stage	0.232
	SRR8316902	Silver flowering stage	0.628
	SRR8316904	Silver flowering stage	1.513
	SRR8316905	Silver flowering stage	0.635
	SRR8316906	Gold flowering stage	0.358
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	2.271
	SRR6706287	Light intensity 50%	2.696
	SRR6706288	Light intensity 20%	2.369
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.491
	CNS0095593	Slightly white alabastrum(diploid) 2	2.739
	CNS0095594	Slightly white alabastrum(diploid) 3	3.059
	CNS0095595	Whole white alabastrum(diploid) 2	41.293
	CNS0095596	Whole white alabastrum(diploid) 3	47.838
	CNS0095597	Whole white alabastrum(diploid) 4	78.593
	CNS0095598	Silvery flower (diploied) 1	3.339
	CNS0095599	Silvery flower (diploied) 2	11.832
	CNS0095600	Silvery flower (diploied) 3	1.647
	CNS0095601	Golden flower (diploid) 1	4.329
	CNS0095602	Golden flower (diploid) 2	1.154
	CNS0095603	Golden flower (diploid) 3	1.629
	CNS0095604	Slightly white alabastrum(tetraploid) 1	8.638
	CNS0095605	Slightly white alabastrum(tetraploid) 2	10.646
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.030
	CNS0095607	Whole white alabastrum(tetraploid) 1	61.984
	CNS0095608	Whole white alabastrum(tetraploid) 2	106.731
	CNS0095609	Whole white alabastrum(tetraploid) 3	31.821
	CNS0095610	Silvery flower (tetraploid) 1	2.108
	CNS0095611	Silvery flower (tetraploid) 2	5.230
	CNS0095612	Silvery flower (tetraploid) 3	15.852
	CNS0095613	Golden flower (tetraploid) 1	2.613
	CNS0095614	Golden flower (tetraploid) 2	0.511
	CNS0095615	Golden flower (tetraploid) 3	7.104
CRA001975	CRR073297	Stem 1	0.748
	CRR073298	Stem 2	0.638
	CRR073299	Stem 3	0.509
	CRR073300	Leaf 1	6.541
	CRR073301	Leaf 2	2.568
	CRR073302	Leaf 3	0.357
	CRR073303	Juvenile bud 1	5.303
	CRR073304	Juvenile bud 2	5.058
	CRR073305	Juvenile bud 3	0.953
	CRR073306	Third green 1	3.323
	CRR073307	Third green 2	1.878
	CRR073308	Third green 3	2.725
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.573
	CRR073311	Second white 3	0.593
	CRR073312	Silver flowering 1	3.009
	CRR073313	Silver flowering 2	1.458
	CRR073314	Silver flowering 3	0.928
	CRR073315	Gold flowering 1	6.091
	CRR073316	Gold flowering 2	1.368
	CRR073317	Gold flowering 3	1.270
	CRR073318	Tawny withering 1	3.903
	CRR073319	Tawny withering 2	3.624
	CRR073320	Tawny withering 3	2.924