Gene detail

Detail information of GWHGAAZE028939

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008377674.1	1.16061E-84	PREDICTED: ethylene-responsive transcription factor ERF003-like [Malus domestica]
Swissprot	tr\|Q94AW5\|ERF03_ARATH	9E-73	Ethylene-responsive transcription factor ERF003
trEMBL	tr\|D5L105\|D5L105_MALDO	4E-85	AP2 domain class transcription factor {ECO:0000313\|EMBL:ADE41114.1}
TAIR10	AT5G25190.1	4E-44	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	73444871	73446090	+
GWHAAZE00000008	mRNA	73444871	73446090	+
GWHAAZE00000008	exon	73444871	73445140	+
GWHAAZE00000008	exon	73445600	73446090	+
GWHAAZE00000008	five_prime_UTR	73444871	73445057	+
GWHAAZE00000008	CDS	73445058	73445140	+
GWHAAZE00000008	CDS	73445600	73446086	+
GWHAAZE00000008	three_prime_UTR	73446087	73446090	+

Transcript Sequence
>GWHTAAZE028973 TTTTTCCTTCTCAATTGGCAACCACTCTCTTTGTCTCATTAGTTCATTTAGTCATTTTCACAAACAGTTTCGTAAAAGAAACATTTATATTTTCATAATTGACACATAAGTCTCTCTTTGCCTCACTAGTTGATTGAGGCATCTTCAGAAACACTTTACTACAAGAAACATTTTGGTTTTGCTAATCATGGCTAGAACACAACAGCGATACCGAGGGGTTCGGCAGAGGCATTGGGGCTCTTGGGTCTCTGAAATTCGCCATCCTTTACTGAAGACAAGAATTTGGTTAGGTACATTTGAAACGGCTGAAGACGCGGCTCGGGCCTATGACGAAGCTGCTCGGCTCATGTGCGGCCAAAGGGCTAGAACCAATTTCCCATACAATCCCAGTGCGGCTCAAACTTCATCAGCTAAGCTTCTCTCGGCTAATTTGATAGCCAAGCTTCATAAATGCTATATGGCTTCACTTCAACTGACCAATCCAAAAATACAAGAGCCTCAAATGGGTGTCATTAATACGAAACGTATTTTGGGTAATGCTAAAGAAACGTGTGGATGGTCGCCGGAGAAAGTGGTGGTGCCGCCGCAACAGGAGGAGAAACCGGTGGTGAAGAAAGTGAAAGATGAGAGGAAAGAAGAAGAGTTTAAGGCACTTGAAGAGGATCATATAGAGCAAATGATTGAGGAATTGGTCCATTATGGGACTATTGAGCTTTGTTCTGTTTTGCCACCTGAAGCTAATGTAAATATAGTGTAAAACA

Network for GWHGAAZE028939

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	7	56	1.00E-11

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	28.160
	SRR3591706	second leaf	1.336
	SRR3591707	mature leaf	0.158
	SRR3591708	Shoot apex	3.716
	SRR3591709	Stem	2.446
	SRR3591710	White floral bud	2.008
	SRR3591711	White flower	2.909
	SRR3591712	Green floral bud	1.201
	SRR3591713	Yellow flower	1.001
SRP173429	SRR8316895	Juvenile bud stage	0.400
	SRR8316896	Juvenile bud stage	0.262
	SRR8316897	Juvenile bud stage	0.338
	SRR8316894	Third green stage	0.495
	SRR8316900	Third green stage	0.241
	SRR8316901	Third green stage	0.282
	SRR8316898	Complete white stage	0.075
	SRR8316899	Complete white stage	0.792
	SRR8316903	Complete white stage	1.006
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.413
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.185
	SRR8316908	Gold flowering stage	0.130
SRP132670	SRR6706286	Control	1.059
	SRR6706287	Light intensity 50%	0.980
	SRR6706288	Light intensity 20%	0.684
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.703
	CNS0095593	Slightly white alabastrum(diploid) 2	0.664
	CNS0095594	Slightly white alabastrum(diploid) 3	0.832
	CNS0095595	Whole white alabastrum(diploid) 2	0.305
	CNS0095596	Whole white alabastrum(diploid) 3	1.379
	CNS0095597	Whole white alabastrum(diploid) 4	0.300
	CNS0095598	Silvery flower (diploied) 1	0.908
	CNS0095599	Silvery flower (diploied) 2	1.279
	CNS0095600	Silvery flower (diploied) 3	0.633
	CNS0095601	Golden flower (diploid) 1	1.528
	CNS0095602	Golden flower (diploid) 2	1.743
	CNS0095603	Golden flower (diploid) 3	1.952
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.709
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.968
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.715
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.248
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.791
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.573
	CNS0095610	Silvery flower (tetraploid) 1	1.026
	CNS0095611	Silvery flower (tetraploid) 2	1.002
	CNS0095612	Silvery flower (tetraploid) 3	0.919
	CNS0095613	Golden flower (tetraploid) 1	0.370
	CNS0095614	Golden flower (tetraploid) 2	1.526
	CNS0095615	Golden flower (tetraploid) 3	4.501
CRA001975	CRR073297	Stem 1	2.292
	CRR073298	Stem 2	3.195
	CRR073299	Stem 3	2.756
	CRR073300	Leaf 1	1.824
	CRR073301	Leaf 2	1.738
	CRR073302	Leaf 3	1.360
	CRR073303	Juvenile bud 1	0.227
	CRR073304	Juvenile bud 2	1.699
	CRR073305	Juvenile bud 3	1.179
	CRR073306	Third green 1	0.624
	CRR073307	Third green 2	0.721
	CRR073308	Third green 3	2.019
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.535
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.249
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	3.989
	CRR073316	Gold flowering 2	3.388
	CRR073317	Gold flowering 3	0.791
	CRR073318	Tawny withering 1	3.339
	CRR073319	Tawny withering 2	0.771
	CRR073320	Tawny withering 3	1.806