Gene detail

Detail information of GWHGAAZE028908

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002525963.1	1.65592E-22	transcription factor, putative [Ricinus communis]
Swissprot	tr\|Q9FRV4\|NAC54_ARATH	1E-11	Protein CUP-SHAPED COTYLEDON 1
trEMBL	tr\|B9SIZ4\|B9SIZ4_RICCO	6E-23	Transcription factor, putative {ECO:0000313\|EMBL:EEF36387.1}
TAIR10	AT5G13180.1	3E-11	NAC domain containing protein 83

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	72717397	72717897	-
GWHAAZE00000008	mRNA	72717397	72717897	-
GWHAAZE00000008	exon	72717397	72717897	-
GWHAAZE00000008	CDS	72717397	72717897	-

Transcript Sequence
>GWHTAAZE028942 ATGAGTTATCCTTTGCCGCTGGGTTTTAAGTTTTTGCCGACAGACAACCAGTTGATAACATACCTAATCCACAAGATCCGAGATGAACCATTGCCCTGCGAGGGAATTATCTCGGAGACTGACGTATTCGGTGAGAGACCGCCGTCGGAACTATTTGGTGGCAGTGATCGTCATGGTGGTGATGTAAGATATTTCTTCACCTTGTTAAAAAAGAAGACCGAAAACAGCACGAAGAATTACATGAAGCGCAGCGTTGGCGATATAGGTACGTGGCATGCCGATTCCAAGGGTGTTCGAATCAGGGATCCCCAGACCCAGAAAGTCATCGGCAACAGAAAAGCTTTTAATTTTAAGTTCAAGGCTACTTCGATGAGTGGGCCATCGAATGGTGATGATTTTAGATGGCTAATGACGGAGTACAGTCTCGATGGAGTTTCTCTCAAATATAAGAAGCCCGGTCCAGATTACGTGCTTTGCAGAATCAAGAAGAAAAACCTCCTC

Network for GWHGAAZE028908

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02365.16	NAM	6	142	1.10E-19

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NAC

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.160
	SRR3591707	mature leaf	0.166
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.014
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	1.809
	SRR8316896	Juvenile bud stage	1.498
	SRR8316897	Juvenile bud stage	1.146
	SRR8316894	Third green stage	0.339
	SRR8316900	Third green stage	1.140
	SRR8316901	Third green stage	0.976
	SRR8316898	Complete white stage	0.424
	SRR8316899	Complete white stage	1.273
	SRR8316903	Complete white stage	1.043
	SRR8316902	Silver flowering stage	0.028
	SRR8316904	Silver flowering stage	0.595
	SRR8316905	Silver flowering stage	0.112
	SRR8316906	Gold flowering stage	0.732
	SRR8316907	Gold flowering stage	0.952
	SRR8316908	Gold flowering stage	0.776
SRP132670	SRR6706286	Control	0.944
	SRR6706287	Light intensity 50%	0.547
	SRR6706288	Light intensity 20%	0.315
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.495
	CNS0095593	Slightly white alabastrum(diploid) 2	1.287
	CNS0095594	Slightly white alabastrum(diploid) 3	0.499
	CNS0095595	Whole white alabastrum(diploid) 2	0.202
	CNS0095596	Whole white alabastrum(diploid) 3	0.408
	CNS0095597	Whole white alabastrum(diploid) 4	0.303
	CNS0095598	Silvery flower (diploied) 1	1.542
	CNS0095599	Silvery flower (diploied) 2	0.071
	CNS0095600	Silvery flower (diploied) 3	0.731
	CNS0095601	Golden flower (diploid) 1	1.419
	CNS0095602	Golden flower (diploid) 2	0.737
	CNS0095603	Golden flower (diploid) 3	0.829
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.481
	CRR073298	Stem 2	0.878
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.442
	CRR073301	Leaf 2	1.423
	CRR073302	Leaf 3	0.276
	CRR073303	Juvenile bud 1	0.104
	CRR073304	Juvenile bud 2	0.101
	CRR073305	Juvenile bud 3	0.133
	CRR073306	Third green 1	0.313
	CRR073307	Third green 2	0.119
	CRR073308	Third green 3	0.772
	CRR073309	Second white 1	0.076
	CRR073310	Second white 2	0.090
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.431
	CRR073316	Gold flowering 2	0.593
	CRR073317	Gold flowering 3	0.130
	CRR073318	Tawny withering 1	0.553
	CRR073319	Tawny withering 2	0.448
	CRR073320	Tawny withering 3	0.000