Gene detail

Detail information of GWHGAAZE028755

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDP33613.1	1.68188E-69	hypothetical protein JCGZ_07184 [Jatropha curcas]
Swissprot	tr\|Q9SM50\|HY5_SOLLC	2E-68	Transcription factor HY5
trEMBL	tr\|A0A067KF35\|A0A067KF35_JATCU	6E-70	Uncharacterized protein {ECO:0000313\|EMBL:KDP33613.1}
TAIR10	AT5G11260.1	3E-25	Basic-leucine zipper (bZIP) transcription factor family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	67924840	67927816	+
GWHAAZE00000008	mRNA	67924840	67927816	+
GWHAAZE00000008	exon	67924840	67924939	+
GWHAAZE00000008	exon	67925893	67926073	+
GWHAAZE00000008	exon	67927216	67927372	+
GWHAAZE00000008	exon	67927772	67927816	+
GWHAAZE00000008	CDS	67924840	67924939	+
GWHAAZE00000008	CDS	67925893	67926073	+
GWHAAZE00000008	CDS	67927216	67927372	+
GWHAAZE00000008	CDS	67927772	67927816	+

Transcript Sequence
>GWHTAAZE028789 ATGCAAGAGCAAGCTGCAACTACTAGTTCGATTGCGGCGAGCTTACCTTCCAGTAGTGAAAGATCTTCAAGCTCTGCTTTTCAAATTGAAGTTAAAGAAGGTATGGAGAGTGATGACGAGATCAGAAGAGTGCCAGAGATGGGCGGAGAAGCCGCGGGCATGTCAGGTTCCGGTCGAGAAACCGGTTCAATAACCGGTCAGGACCGGGTTCAGGGGTCAGTAGACGGTTCGAGAAAGAGAGGCAGAAGTCCGGCTGAGAAAGAGAACAAGCGGCTCAAAAGGTTGCTGAGGAACAGAGTATCAGCACAGCAGGCAAGGGAGAGGAAGAAGGCATATTTAAGTGAATTGGAGGTGAGGGTTAAAGAGCTGGAAAAGAAGAACTCTGAGCTGGAGGAGAGGCTTTCCACTTTGCAAAATGAGAATCAAATGCTTAGACATATATTGAAGAACACTACAGCAGGGATGCAGGAGGGGAGGAAGTAG

Network for GWHGAAZE028755

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00170.22	bZIP_1	86	147	1.90E-14

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	bZIP

KEGG pathway

KO	Enzyme	pathway	mapID
K16241	HY5	Circadian rhythm - plant	map04712

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0005634	cellular_component	nucleus
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	44.811
	SRR3591706	second leaf	53.385
	SRR3591707	mature leaf	62.498
	SRR3591708	Shoot apex	49.183
	SRR3591709	Stem	51.233
	SRR3591710	White floral bud	38.306
	SRR3591711	White flower	114.460
	SRR3591712	Green floral bud	44.535
	SRR3591713	Yellow flower	72.614
SRP173429	SRR8316895	Juvenile bud stage	28.943
	SRR8316896	Juvenile bud stage	53.202
	SRR8316897	Juvenile bud stage	22.892
	SRR8316894	Third green stage	21.910
	SRR8316900	Third green stage	77.165
	SRR8316901	Third green stage	85.056
	SRR8316898	Complete white stage	30.601
	SRR8316899	Complete white stage	91.348
	SRR8316903	Complete white stage	59.175
	SRR8316902	Silver flowering stage	60.418
	SRR8316904	Silver flowering stage	70.406
	SRR8316905	Silver flowering stage	55.526
	SRR8316906	Gold flowering stage	102.658
	SRR8316907	Gold flowering stage	86.642
	SRR8316908	Gold flowering stage	104.933
SRP132670	SRR6706286	Control	185.799
	SRR6706287	Light intensity 50%	154.064
	SRR6706288	Light intensity 20%	146.659
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	40.631
	CNS0095593	Slightly white alabastrum(diploid) 2	49.693
	CNS0095594	Slightly white alabastrum(diploid) 3	43.733
	CNS0095595	Whole white alabastrum(diploid) 2	42.018
	CNS0095596	Whole white alabastrum(diploid) 3	36.583
	CNS0095597	Whole white alabastrum(diploid) 4	48.013
	CNS0095598	Silvery flower (diploied) 1	94.132
	CNS0095599	Silvery flower (diploied) 2	127.170
	CNS0095600	Silvery flower (diploied) 3	144.507
	CNS0095601	Golden flower (diploid) 1	127.926
	CNS0095602	Golden flower (diploid) 2	115.023
	CNS0095603	Golden flower (diploid) 3	121.803
	CNS0095604	Slightly white alabastrum(tetraploid) 1	52.731
	CNS0095605	Slightly white alabastrum(tetraploid) 2	43.977
	CNS0095606	Slightly white alabastrum(tetraploid) 3	86.231
	CNS0095607	Whole white alabastrum(tetraploid) 1	36.155
	CNS0095608	Whole white alabastrum(tetraploid) 2	40.469
	CNS0095609	Whole white alabastrum(tetraploid) 3	67.560
	CNS0095610	Silvery flower (tetraploid) 1	158.515
	CNS0095611	Silvery flower (tetraploid) 2	130.012
	CNS0095612	Silvery flower (tetraploid) 3	22.012
	CNS0095613	Golden flower (tetraploid) 1	117.663
	CNS0095614	Golden flower (tetraploid) 2	150.391
	CNS0095615	Golden flower (tetraploid) 3	38.968
CRA001975	CRR073297	Stem 1	22.105
	CRR073298	Stem 2	24.876
	CRR073299	Stem 3	27.027
	CRR073300	Leaf 1	26.232
	CRR073301	Leaf 2	28.868
	CRR073302	Leaf 3	25.165
	CRR073303	Juvenile bud 1	46.947
	CRR073304	Juvenile bud 2	25.363
	CRR073305	Juvenile bud 3	23.508
	CRR073306	Third green 1	16.301
	CRR073307	Third green 2	12.033
	CRR073308	Third green 3	17.166
	CRR073309	Second white 1	11.629
	CRR073310	Second white 2	19.241
	CRR073311	Second white 3	12.576
	CRR073312	Silver flowering 1	8.983
	CRR073313	Silver flowering 2	12.650
	CRR073314	Silver flowering 3	12.767
	CRR073315	Gold flowering 1	8.524
	CRR073316	Gold flowering 2	10.082
	CRR073317	Gold flowering 3	5.036
	CRR073318	Tawny withering 1	23.928
	CRR073319	Tawny withering 2	23.362
	CRR073320	Tawny withering 3	33.999