Gene detail

Detail information of GWHGAAZE028735

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	NP_001234820.1	1.02762E-32	transcription factor HY5 [Solanum lycopersicum]
Swissprot	tr\|Q9SM50\|HY5_SOLLC	5E-35	Transcription factor HY5
trEMBL	tr\|A0A022QUH4\|A0A022QUH4_ERYGU	1E-32	Uncharacterized protein {ECO:0000313\|EMBL:EYU32337.1}
TAIR10	AT5G11260.1	4E-13	Basic-leucine zipper (bZIP) transcription factor family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	67187612	67188224	+
GWHAAZE00000008	mRNA	67187612	67188224	+
GWHAAZE00000008	exon	67187612	67187767	+
GWHAAZE00000008	exon	67188180	67188224	+
GWHAAZE00000008	CDS	67187612	67187767	+
GWHAAZE00000008	CDS	67188180	67188224	+

Transcript Sequence
>GWHTAAZE028769 CTGTTGAGGAACAGAGTATCAGCACAGCAGGCAAGGGAGAGAAAGAAGGCATATTTAAGCGAATTGGAGGTGAGGGTTAAAGAGCTGGAAAAGAAGAACTCTGAGCTGGAGGAGAGGCTTTCCACTTTGCAAAATGAGAATCAAATGCTTAGACATATATTGAAGAACACTACAGCAGGGATGCAGGAGGGGAGGAAGTAG

Network for GWHGAAZE028735

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00170.22	bZIP_1	2	53	6.00E-13

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	bZIP

KEGG pathway

KO	Enzyme	pathway	mapID
K16241	HY5	Circadian rhythm - plant	map04712

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	22.668
	SRR3591706	second leaf	34.777
	SRR3591707	mature leaf	37.952
	SRR3591708	Shoot apex	38.442
	SRR3591709	Stem	49.721
	SRR3591710	White floral bud	19.180
	SRR3591711	White flower	62.954
	SRR3591712	Green floral bud	29.057
	SRR3591713	Yellow flower	43.538
SRP173429	SRR8316895	Juvenile bud stage	4.914
	SRR8316896	Juvenile bud stage	6.986
	SRR8316897	Juvenile bud stage	3.313
	SRR8316894	Third green stage	0.208
	SRR8316900	Third green stage	8.307
	SRR8316901	Third green stage	11.707
	SRR8316898	Complete white stage	3.610
	SRR8316899	Complete white stage	9.940
	SRR8316903	Complete white stage	0.740
	SRR8316902	Silver flowering stage	7.988
	SRR8316904	Silver flowering stage	8.545
	SRR8316905	Silver flowering stage	2.241
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.226
SRP132670	SRR6706286	Control	0.167
	SRR6706287	Light intensity 50%	0.847
	SRR6706288	Light intensity 20%	1.140
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	1.763
	CNS0095595	Whole white alabastrum(diploid) 2	2.574
	CNS0095596	Whole white alabastrum(diploid) 3	2.531
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.288
	CNS0095599	Silvery flower (diploied) 2	0.050
	CNS0095600	Silvery flower (diploied) 3	6.320
	CNS0095601	Golden flower (diploid) 1	2.885
	CNS0095602	Golden flower (diploid) 2	0.205
	CNS0095603	Golden flower (diploid) 3	0.054
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.214
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.462
	CNS0095606	Slightly white alabastrum(tetraploid) 3	7.213
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.345
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.569
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.657
	CNS0095610	Silvery flower (tetraploid) 1	17.913
	CNS0095611	Silvery flower (tetraploid) 2	11.303
	CNS0095612	Silvery flower (tetraploid) 3	0.634
	CNS0095613	Golden flower (tetraploid) 1	11.724
	CNS0095614	Golden flower (tetraploid) 2	9.206
	CNS0095615	Golden flower (tetraploid) 3	2.656
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.021
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.025
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.168
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.239
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.050