Gene detail

Detail information of GWHGAAZE028719

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	NP_001284656.1	2.56501E-62	uncharacterized protein LOC103488299 [Cucumis melo]
Swissprot	tr\|Q9SM50\|HY5_SOLLC	5E-62	Transcription factor HY5
trEMBL	tr\|A0A0A0LPK1\|A0A0A0LPK1_CUCSA	1E-62	Uncharacterized protein {ECO:0000313\|EMBL:KGN62939.1}
TAIR10	AT5G11260.1	2E-22	Basic-leucine zipper (bZIP) transcription factor family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	66807820	66809736	+
GWHAAZE00000008	mRNA	66807820	66809736	+
GWHAAZE00000008	exon	66807820	66807998	+
GWHAAZE00000008	exon	66809140	66809296	+
GWHAAZE00000008	exon	66809692	66809736	+
GWHAAZE00000008	CDS	66807820	66807998	+
GWHAAZE00000008	CDS	66809140	66809296	+
GWHAAZE00000008	CDS	66809692	66809736	+

Transcript Sequence
>GWHTAAZE028753 ATGGAGAGTGATGACGAGATCAGAAGAGTGCCAGAGATGGGCGGAGAAGCCGCGGGCATGTCAGGTTCCGGTCGAGAAACCGGTTCAATAACCGGTCAGGACCGGGTTCAGGGGTCAGTAGACGGTTCGAGAAAGAGAGGCAGAAGTCCGGCTGAGAAAGAGAACAAGCGGCTCAAAAGGTTGCTGAGGAACAGAGTATCAGCACAGCAGGCAAGGGAGAGGAAGAAGGCATATTTAAGTGAATTGGAGGTGAGGGTTAAAGAGCTGGAAAAGAAGAACTCTGAGCTGGAGGAGAGGCTTTCCACTTTGCAAAATGAGAATCAAATGCTTAGACATATATTGAAGAACACTACAGCAGGGATGCAGGAGGGGAGGAAGTAG

Network for GWHGAAZE028719

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00170.22	bZIP_1	52	113	7.30E-15

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	bZIP

KEGG pathway

KO	Enzyme	pathway	mapID
K16241	HY5	Circadian rhythm - plant	map04712

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0005634	cellular_component	nucleus
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	17.363
	SRR3591706	second leaf	41.553
	SRR3591707	mature leaf	48.464
	SRR3591708	Shoot apex	45.285
	SRR3591709	Stem	49.853
	SRR3591710	White floral bud	27.533
	SRR3591711	White flower	85.268
	SRR3591712	Green floral bud	36.670
	SRR3591713	Yellow flower	46.926
SRP173429	SRR8316895	Juvenile bud stage	39.717
	SRR8316896	Juvenile bud stage	55.123
	SRR8316897	Juvenile bud stage	22.514
	SRR8316894	Third green stage	21.677
	SRR8316900	Third green stage	81.709
	SRR8316901	Third green stage	92.288
	SRR8316898	Complete white stage	31.948
	SRR8316899	Complete white stage	94.571
	SRR8316903	Complete white stage	50.925
	SRR8316902	Silver flowering stage	58.821
	SRR8316904	Silver flowering stage	67.404
	SRR8316905	Silver flowering stage	51.422
	SRR8316906	Gold flowering stage	89.792
	SRR8316907	Gold flowering stage	72.826
	SRR8316908	Gold flowering stage	98.178
SRP132670	SRR6706286	Control	169.673
	SRR6706287	Light intensity 50%	138.726
	SRR6706288	Light intensity 20%	131.667
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	42.489
	CNS0095593	Slightly white alabastrum(diploid) 2	56.825
	CNS0095594	Slightly white alabastrum(diploid) 3	46.014
	CNS0095595	Whole white alabastrum(diploid) 2	48.144
	CNS0095596	Whole white alabastrum(diploid) 3	42.222
	CNS0095597	Whole white alabastrum(diploid) 4	59.408
	CNS0095598	Silvery flower (diploied) 1	106.614
	CNS0095599	Silvery flower (diploied) 2	130.448
	CNS0095600	Silvery flower (diploied) 3	149.140
	CNS0095601	Golden flower (diploid) 1	133.152
	CNS0095602	Golden flower (diploid) 2	116.934
	CNS0095603	Golden flower (diploid) 3	114.855
	CNS0095604	Slightly white alabastrum(tetraploid) 1	59.365
	CNS0095605	Slightly white alabastrum(tetraploid) 2	50.110
	CNS0095606	Slightly white alabastrum(tetraploid) 3	91.787
	CNS0095607	Whole white alabastrum(tetraploid) 1	45.678
	CNS0095608	Whole white alabastrum(tetraploid) 2	44.566
	CNS0095609	Whole white alabastrum(tetraploid) 3	66.454
	CNS0095610	Silvery flower (tetraploid) 1	159.863
	CNS0095611	Silvery flower (tetraploid) 2	127.291
	CNS0095612	Silvery flower (tetraploid) 3	21.488
	CNS0095613	Golden flower (tetraploid) 1	123.276
	CNS0095614	Golden flower (tetraploid) 2	148.534
	CNS0095615	Golden flower (tetraploid) 3	36.118
CRA001975	CRR073297	Stem 1	21.230
	CRR073298	Stem 2	22.936
	CRR073299	Stem 3	13.016
	CRR073300	Leaf 1	22.187
	CRR073301	Leaf 2	27.695
	CRR073302	Leaf 3	20.129
	CRR073303	Juvenile bud 1	6.502
	CRR073304	Juvenile bud 2	19.437
	CRR073305	Juvenile bud 3	19.076
	CRR073306	Third green 1	12.799
	CRR073307	Third green 2	9.259
	CRR073308	Third green 3	8.272
	CRR073309	Second white 1	6.661
	CRR073310	Second white 2	14.450
	CRR073311	Second white 3	8.837
	CRR073312	Silver flowering 1	6.699
	CRR073313	Silver flowering 2	4.380
	CRR073314	Silver flowering 3	8.526
	CRR073315	Gold flowering 1	2.549
	CRR073316	Gold flowering 2	4.337
	CRR073317	Gold flowering 3	1.434
	CRR073318	Tawny withering 1	18.189
	CRR073319	Tawny withering 2	16.178
	CRR073320	Tawny withering 3	4.819