Gene detail

Detail information of GWHGAAZE028561

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008438277.1	1.8663E-106	PREDICTED: ATP synthase subunit delta', mitochondrial [Cucumis melo]
COG	YP_005030605.1	2E-15	ATP synthase, F1 sector, epsilon subunit epsilon
Swissprot	tr\|Q40089\|ATP4_IPOBA	2E-107	ATP synthase subunit delta', mitochondrial (Precursor)
trEMBL	tr\|A0A059C4E2\|A0A059C4E2_EUCGR	1E-105	Uncharacterized protein {ECO:0000313\|EMBL:KCW73232.1}
TAIR10	AT5G47030.1	2E-80	ATPase, F1 complex, delta/epsilon subunit

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	59919779	59923576	+
GWHAAZE00000008	mRNA	59919779	59923576	+
GWHAAZE00000008	exon	59919779	59919991	+
GWHAAZE00000008	exon	59923232	59923576	+
GWHAAZE00000008	CDS	59919779	59919991	+
GWHAAZE00000008	CDS	59923232	59923576	+

Transcript Sequence
>GWHTAAZE028595 GTTAAATCCCGCCCCTTCTCCACCGACCTCCAGGCTGATCCGGTCACTGACGATGCCTTCGTCGACTCCTGGAAGAAGATGATACCAAACATAGATCCACCGAAAACTCCTATGGCTTATATGAAGCCTCGCCCTTCAACCCCTTCTTCCATCCCTTCTAAGCTCACTGTTAATTTCGTTCTTCCTTACTCTTCCGAACTTTCTGGAAAAGAGGTTGATATGGTCATAGTTCCAGCCTCAACTGGGCAGATGGGTATTCTACCGGGACATGTGCCCACAATCACTGAACTGAAACCGGGCCTCCTATCAGTACACGAAGGAAACGATACGAAGAAATACTTTGTCAGCAGCGGCTTTGCATTTGTCCATGCCAATTCCTACGCAGACATAATTGCGGTCGAGGCCGTTCCGATTGACCAAATTGACCCGGCCCTGGTCCAGAAGGGCCTAGCCGAGTTCACCCAGAAGCTGAACTCGGCATCGAGTGATTTGGATAAAGCTGAAGCTCAAATTGGGGTGGATGTCCACAGTGCTATGAGTTCTGCTCTTGCAGGCTAG

Network for GWHGAAZE028561

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02823.17	ATP-synt_DE_N	55	126	7.80E-19

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02134	ATPeF1D, ATP5D, ATP16	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Thermogenesis	map04714

Gene Ontology

GO term	Ontology	Name
GO:0015986	biological_process	ATP synthesis coupled proton transport
GO:0045261	cellular_component	proton-transporting ATP synthase complex, catalytic core F(1)
GO:0046933	molecular_function	proton-transporting ATP synthase activity, rotational mechanism

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	142.299
	SRR3591706	second leaf	62.527
	SRR3591707	mature leaf	38.771
	SRR3591708	Shoot apex	105.881
	SRR3591709	Stem	124.121
	SRR3591710	White floral bud	107.775
	SRR3591711	White flower	147.880
	SRR3591712	Green floral bud	173.023
	SRR3591713	Yellow flower	134.918
SRP173429	SRR8316895	Juvenile bud stage	97.463
	SRR8316896	Juvenile bud stage	149.270
	SRR8316897	Juvenile bud stage	0.880
	SRR8316894	Third green stage	54.956
	SRR8316900	Third green stage	241.279
	SRR8316901	Third green stage	232.736
	SRR8316898	Complete white stage	83.290
	SRR8316899	Complete white stage	211.516
	SRR8316903	Complete white stage	138.202
	SRR8316902	Silver flowering stage	111.616
	SRR8316904	Silver flowering stage	120.136
	SRR8316905	Silver flowering stage	72.158
	SRR8316906	Gold flowering stage	191.707
	SRR8316907	Gold flowering stage	250.428
	SRR8316908	Gold flowering stage	85.299
SRP132670	SRR6706286	Control	165.734
	SRR6706287	Light intensity 50%	175.407
	SRR6706288	Light intensity 20%	174.155
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	161.180
	CNS0095593	Slightly white alabastrum(diploid) 2	181.295
	CNS0095594	Slightly white alabastrum(diploid) 3	155.862
	CNS0095595	Whole white alabastrum(diploid) 2	172.470
	CNS0095596	Whole white alabastrum(diploid) 3	194.812
	CNS0095597	Whole white alabastrum(diploid) 4	168.058
	CNS0095598	Silvery flower (diploied) 1	104.547
	CNS0095599	Silvery flower (diploied) 2	125.208
	CNS0095600	Silvery flower (diploied) 3	235.272
	CNS0095601	Golden flower (diploid) 1	112.265
	CNS0095602	Golden flower (diploid) 2	193.041
	CNS0095603	Golden flower (diploid) 3	178.580
	CNS0095604	Slightly white alabastrum(tetraploid) 1	111.149
	CNS0095605	Slightly white alabastrum(tetraploid) 2	105.637
	CNS0095606	Slightly white alabastrum(tetraploid) 3	110.559
	CNS0095607	Whole white alabastrum(tetraploid) 1	111.920
	CNS0095608	Whole white alabastrum(tetraploid) 2	126.266
	CNS0095609	Whole white alabastrum(tetraploid) 3	142.231
	CNS0095610	Silvery flower (tetraploid) 1	138.919
	CNS0095611	Silvery flower (tetraploid) 2	183.894
	CNS0095612	Silvery flower (tetraploid) 3	205.897
	CNS0095613	Golden flower (tetraploid) 1	128.811
	CNS0095614	Golden flower (tetraploid) 2	138.642
	CNS0095615	Golden flower (tetraploid) 3	200.835
CRA001975	CRR073297	Stem 1	113.403
	CRR073298	Stem 2	117.346
	CRR073299	Stem 3	138.185
	CRR073300	Leaf 1	158.796
	CRR073301	Leaf 2	172.513
	CRR073302	Leaf 3	199.665
	CRR073303	Juvenile bud 1	239.078
	CRR073304	Juvenile bud 2	231.987
	CRR073305	Juvenile bud 3	256.782
	CRR073306	Third green 1	210.630
	CRR073307	Third green 2	226.114
	CRR073308	Third green 3	174.909
	CRR073309	Second white 1	367.692
	CRR073310	Second white 2	185.488
	CRR073311	Second white 3	154.205
	CRR073312	Silver flowering 1	184.951
	CRR073313	Silver flowering 2	236.635
	CRR073314	Silver flowering 3	160.160
	CRR073315	Gold flowering 1	55.918
	CRR073316	Gold flowering 2	47.560
	CRR073317	Gold flowering 3	59.039
	CRR073318	Tawny withering 1	124.339
	CRR073319	Tawny withering 2	110.829
	CRR073320	Tawny withering 3	119.767