Gene detail

Detail information of GWHGAAZE028279

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002284657.1	1.04994E-28	PREDICTED: DNA-directed RNA polymerase III subunit rpc1 [Vitis vinifera]
COG	NP_248037.1	2E-11	DNA-directed RNA polymerase subunit A
Swissprot	tr\|P18616\|NRPB1_ARATH	2E-13	DNA-directed RNA polymerase II subunit 1
trEMBL	tr\|F6GTW0\|F6GTW0_VITVI	2E-31	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB43624.1}
TAIR10	AT5G60040.2	3E-22	nuclear RNA polymerase C1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	49501239	49501897	+
GWHAAZE00000008	mRNA	49501239	49501897	+
GWHAAZE00000008	exon	49501239	49501281	+
GWHAAZE00000008	exon	49501593	49501897	+
GWHAAZE00000008	CDS	49501239	49501281	+
GWHAAZE00000008	CDS	49501593	49501897	+

Transcript Sequence
>GWHTAAZE028313 ATGACATTAAAAACTTTCCACTTTGCTGGAGTTGCAAGCATGAATGTTACACTTGGGGTTCCTCGTATCAAGGAAATTATAAATGCAGCCAAGAAAATTAGCACGCCCATCATTACGACCAAACTTGAATGTCCCGATAATGCGAAAACTGCAAGAATGGTGAAAGGTCGTATTGAGAAAACATATTTAGGCCAGGTAAAATTAATTCATCATTGTCTATCTGATAATTATCCACAGGAATTGAACGCAGTTTCCTGTATAAATATGCTGGTCAATTATATTGTATCAAAATCATTCCTCAATCATCTCTCTCTCTCTATATATATATTGTGTTGGCCCTTAAGTTGA

Network for GWHGAAZE028279

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04998.18	RNA_pol_Rpb1_5	1	71	1.60E-13

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03018	RPC1, POLR3A	RNA polymerase	map03020
K03018	RPC1, POLR3A	Cytosolic DNA-sensing pathway	map04623

Gene Ontology

GO term	Ontology	Name
GO:0006351	biological_process	transcription, DNA-templated
GO:0003677	molecular_function	DNA binding
GO:0003899	molecular_function	DNA-directed 5'-3' RNA polymerase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	6.608
	SRR3591706	second leaf	2.209
	SRR3591707	mature leaf	2.121
	SRR3591708	Shoot apex	7.523
	SRR3591709	Stem	6.880
	SRR3591710	White floral bud	4.128
	SRR3591711	White flower	9.220
	SRR3591712	Green floral bud	7.119
	SRR3591713	Yellow flower	4.944
SRP173429	SRR8316895	Juvenile bud stage	5.514
	SRR8316896	Juvenile bud stage	4.625
	SRR8316897	Juvenile bud stage	3.027
	SRR8316894	Third green stage	2.259
	SRR8316900	Third green stage	5.983
	SRR8316901	Third green stage	6.105
	SRR8316898	Complete white stage	1.574
	SRR8316899	Complete white stage	6.726
	SRR8316903	Complete white stage	1.858
	SRR8316902	Silver flowering stage	1.610
	SRR8316904	Silver flowering stage	3.376
	SRR8316905	Silver flowering stage	1.488
	SRR8316906	Gold flowering stage	4.783
	SRR8316907	Gold flowering stage	2.656
	SRR8316908	Gold flowering stage	3.308
SRP132670	SRR6706286	Control	0.465
	SRR6706287	Light intensity 50%	1.080
	SRR6706288	Light intensity 20%	1.090
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	5.351
	CNS0095593	Slightly white alabastrum(diploid) 2	2.296
	CNS0095594	Slightly white alabastrum(diploid) 3	3.662
	CNS0095595	Whole white alabastrum(diploid) 2	2.531
	CNS0095596	Whole white alabastrum(diploid) 3	2.278
	CNS0095597	Whole white alabastrum(diploid) 4	4.263
	CNS0095598	Silvery flower (diploied) 1	4.214
	CNS0095599	Silvery flower (diploied) 2	4.112
	CNS0095600	Silvery flower (diploied) 3	3.949
	CNS0095601	Golden flower (diploid) 1	1.292
	CNS0095602	Golden flower (diploid) 2	3.773
	CNS0095603	Golden flower (diploid) 3	3.967
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.011
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.779
	CNS0095606	Slightly white alabastrum(tetraploid) 3	9.477
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.036
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.080
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.193
	CNS0095610	Silvery flower (tetraploid) 1	5.419
	CNS0095611	Silvery flower (tetraploid) 2	4.998
	CNS0095612	Silvery flower (tetraploid) 3	3.792
	CNS0095613	Golden flower (tetraploid) 1	2.602
	CNS0095614	Golden flower (tetraploid) 2	3.713
	CNS0095615	Golden flower (tetraploid) 3	2.480
CRA001975	CRR073297	Stem 1	2.068
	CRR073298	Stem 2	2.257
	CRR073299	Stem 3	0.814
	CRR073300	Leaf 1	2.488
	CRR073301	Leaf 2	1.689
	CRR073302	Leaf 3	0.868
	CRR073303	Juvenile bud 1	1.211
	CRR073304	Juvenile bud 2	0.936
	CRR073305	Juvenile bud 3	1.355
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.495
	CRR073310	Second white 2	2.028
	CRR073311	Second white 3	0.184
	CRR073312	Silver flowering 1	0.084
	CRR073313	Silver flowering 2	1.202
	CRR073314	Silver flowering 3	0.273
	CRR073315	Gold flowering 1	1.956
	CRR073316	Gold flowering 2	1.742
	CRR073317	Gold flowering 3	0.552
	CRR073318	Tawny withering 1	0.957
	CRR073319	Tawny withering 2	2.219
	CRR073320	Tawny withering 3	0.714