Gene detail

Detail information of GWHGAAZE028278

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDP44150.1	3.62734E-58	hypothetical protein JCGZ_05617 [Jatropha curcas]
COG	YP_001030597.1	3E-31	DNA-directed RNA polymerase subunit A'
Swissprot	tr\|P18616\|NRPB1_ARATH	1E-31	DNA-directed RNA polymerase II subunit 1
trEMBL	tr\|A0A067LHS5\|A0A067LHS5_JATCU	1E-58	DNA-directed RNA polymerase {ECO:0000256\|RuleBase:RU004279}
TAIR10	AT5G60040.2	4E-50	nuclear RNA polymerase C1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	49495852	49497589	+
GWHAAZE00000008	mRNA	49495852	49497589	+
GWHAAZE00000008	exon	49495852	49496043	+
GWHAAZE00000008	exon	49497476	49497589	+
GWHAAZE00000008	CDS	49495852	49496043	+
GWHAAZE00000008	CDS	49497476	49497589	+

Transcript Sequence
>GWHTAAZE028312 GTTTGTATGGAAGGACTTCATTGGAGGAACAGCCCTTTAATTATGTCACAGTGTGGTTCGAAAGGATCTCCTATAAACATTAGTCAGATGATTGCATGTGTTGGCCAGCAATCGGTCGGAGGTAAACGAGCTCCGAATGGATTTATAGATCGAAGCCTTCCTCATTTTAAACGAATGTCGAAGACCCCTGATGCTAAAGGATTTGTTGCGAACTCATTTTATAGTGGTCTAACAGCCACTGAATTTTTCTTCCATACAATGGGAGGGCGAGAAGGTCTTGTGGATACGGCGGTATGCTCAGTTTGA

Network for GWHGAAZE028278

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF05000.18	RNA_pol_Rpb1_4	3	69	2.40E-25
PF04998.18	RNA_pol_Rpb1_5	76	98	7.90E-09

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03018	RPC1, POLR3A	RNA polymerase	map03020
K03018	RPC1, POLR3A	Cytosolic DNA-sensing pathway	map04623

Gene Ontology

GO term	Ontology	Name
GO:0006351	biological_process	transcription, DNA-templated
GO:0003677	molecular_function	DNA binding
GO:0003899	molecular_function	DNA-directed 5'-3' RNA polymerase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	8.744
	SRR3591706	second leaf	3.093
	SRR3591707	mature leaf	3.364
	SRR3591708	Shoot apex	7.513
	SRR3591709	Stem	5.832
	SRR3591710	White floral bud	7.158
	SRR3591711	White flower	7.310
	SRR3591712	Green floral bud	10.491
	SRR3591713	Yellow flower	4.246
SRP173429	SRR8316895	Juvenile bud stage	3.424
	SRR8316896	Juvenile bud stage	5.975
	SRR8316897	Juvenile bud stage	3.667
	SRR8316894	Third green stage	2.436
	SRR8316900	Third green stage	6.316
	SRR8316901	Third green stage	6.352
	SRR8316898	Complete white stage	1.905
	SRR8316899	Complete white stage	5.666
	SRR8316903	Complete white stage	2.664
	SRR8316902	Silver flowering stage	3.781
	SRR8316904	Silver flowering stage	2.989
	SRR8316905	Silver flowering stage	1.916
	SRR8316906	Gold flowering stage	3.938
	SRR8316907	Gold flowering stage	4.232
	SRR8316908	Gold flowering stage	4.673
SRP132670	SRR6706286	Control	5.172
	SRR6706287	Light intensity 50%	7.572
	SRR6706288	Light intensity 20%	7.044
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.486
	CNS0095593	Slightly white alabastrum(diploid) 2	1.552
	CNS0095594	Slightly white alabastrum(diploid) 3	2.917
	CNS0095595	Whole white alabastrum(diploid) 2	2.111
	CNS0095596	Whole white alabastrum(diploid) 3	2.984
	CNS0095597	Whole white alabastrum(diploid) 4	3.310
	CNS0095598	Silvery flower (diploied) 1	4.426
	CNS0095599	Silvery flower (diploied) 2	5.510
	CNS0095600	Silvery flower (diploied) 3	7.612
	CNS0095601	Golden flower (diploid) 1	5.502
	CNS0095602	Golden flower (diploid) 2	4.178
	CNS0095603	Golden flower (diploid) 3	4.755
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.441
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.556
	CNS0095606	Slightly white alabastrum(tetraploid) 3	9.408
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.542
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.555
	CNS0095609	Whole white alabastrum(tetraploid) 3	5.331
	CNS0095610	Silvery flower (tetraploid) 1	7.373
	CNS0095611	Silvery flower (tetraploid) 2	5.992
	CNS0095612	Silvery flower (tetraploid) 3	3.476
	CNS0095613	Golden flower (tetraploid) 1	2.339
	CNS0095614	Golden flower (tetraploid) 2	2.738
	CNS0095615	Golden flower (tetraploid) 3	4.341
CRA001975	CRR073297	Stem 1	10.402
	CRR073298	Stem 2	7.332
	CRR073299	Stem 3	5.221
	CRR073300	Leaf 1	8.977
	CRR073301	Leaf 2	3.567
	CRR073302	Leaf 3	3.581
	CRR073303	Juvenile bud 1	2.043
	CRR073304	Juvenile bud 2	1.893
	CRR073305	Juvenile bud 3	6.386
	CRR073306	Third green 1	0.235
	CRR073307	Third green 2	0.154
	CRR073308	Third green 3	0.914
	CRR073309	Second white 1	0.615
	CRR073310	Second white 2	0.889
	CRR073311	Second white 3	1.471
	CRR073312	Silver flowering 1	0.184
	CRR073313	Silver flowering 2	0.634
	CRR073314	Silver flowering 3	0.837
	CRR073315	Gold flowering 1	4.556
	CRR073316	Gold flowering 2	4.000
	CRR073317	Gold flowering 3	1.939
	CRR073318	Tawny withering 1	1.716
	CRR073319	Tawny withering 2	3.231
	CRR073320	Tawny withering 3	4.649