Gene detail

Detail information of GWHGAAZE027971

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002279257.1	4.04797E-39	PREDICTED: ethylene-responsive transcription factor ERF118 [Vitis vinifera]
Swissprot	tr\|Q9CA27\|EF118_ARATH	4E-20	Ethylene-responsive transcription factor ERF118
trEMBL	tr\|F6HEX1\|F6HEX1_VITVI	2E-39	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB50916.1}
TAIR10	AT1G68550.2	1E-17	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	32993684	32994250	-
GWHAAZE00000008	mRNA	32993684	32994250	-
GWHAAZE00000008	exon	32993684	32994250	-
GWHAAZE00000008	CDS	32993684	32994250	-

Transcript Sequence
>GWHTAAZE028005 ATGATTCGCGAGATTAAACTCGTAATTGGAGATAAACCTCAATCAGTCAAAGCGCCAGAACAATCTTCCTCTTCGTGCCAACAAAGCAGCAATGGTGAGAAAAACCCTAAGAAGAAGGTTTTAACTGTAGAAATCCCAAATCGCCGGCGATCAACTACAAATCTCAGAGGCGTGCGGCAGCGGAAATGGGGCAAATGGGCAGCCGAAATCAAGGACCCGTTTCAAAGGAAGAGGATTTGGTTAGGTACTTATAACACCCCTGAAGAAGCATCAATGGCTTATGATGCAAAGAGGCTGGAGTTTGAAGCAATGGAAAAGAGTTGCAACAACTCTTCTTCTCAACCTCACTCTGTTACTGAGGACTCTGAGAGTGTGTTCTCGCATACATCTCCTTTCTCGGTTCTTGAACTGAGTCATCTTCGCTTTCTCCTGTTAATGGGAAACGAACTGAAAATATTAATGGTAATACAGTTGCAGTTTCAAAGGAGGATGAGCAATTATTGTTGGCTCAAATTGGGGAAAAGCTGGAGTTGGAGCTTGATTCATTGTTTATGGATGATTTTGTGA

Network for GWHGAAZE027971

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	55	103	7.40E-14

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.738
	SRR3591706	second leaf	0.521
	SRR3591707	mature leaf	0.504
	SRR3591708	Shoot apex	1.347
	SRR3591709	Stem	0.392
	SRR3591710	White floral bud	1.629
	SRR3591711	White flower	1.741
	SRR3591712	Green floral bud	1.565
	SRR3591713	Yellow flower	1.597
SRP173429	SRR8316895	Juvenile bud stage	0.180
	SRR8316896	Juvenile bud stage	0.027
	SRR8316897	Juvenile bud stage	0.047
	SRR8316894	Third green stage	0.143
	SRR8316900	Third green stage	0.038
	SRR8316901	Third green stage	0.237
	SRR8316898	Complete white stage	0.038
	SRR8316899	Complete white stage	0.653
	SRR8316903	Complete white stage	0.133
	SRR8316902	Silver flowering stage	0.128
	SRR8316904	Silver flowering stage	0.182
	SRR8316905	Silver flowering stage	0.030
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.087
SRP132670	SRR6706286	Control	0.124
	SRR6706287	Light intensity 50%	0.139
	SRR6706288	Light intensity 20%	0.121
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.296
	CNS0095593	Slightly white alabastrum(diploid) 2	0.266
	CNS0095594	Slightly white alabastrum(diploid) 3	0.730
	CNS0095595	Whole white alabastrum(diploid) 2	0.187
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.034
	CNS0095598	Silvery flower (diploied) 1	0.068
	CNS0095599	Silvery flower (diploied) 2	0.071
	CNS0095600	Silvery flower (diploied) 3	0.358
	CNS0095601	Golden flower (diploid) 1	0.219
	CNS0095602	Golden flower (diploid) 2	0.295
	CNS0095603	Golden flower (diploid) 3	0.324
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.474
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.225
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.504
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.038
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.119
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.559
	CNS0095610	Silvery flower (tetraploid) 1	0.177
	CNS0095611	Silvery flower (tetraploid) 2	0.339
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.386
	CNS0095614	Golden flower (tetraploid) 2	0.874
	CNS0095615	Golden flower (tetraploid) 3	0.429
CRA001975	CRR073297	Stem 1	0.552
	CRR073298	Stem 2	0.328
	CRR073299	Stem 3	0.109
	CRR073300	Leaf 1	0.204
	CRR073301	Leaf 2	0.118
	CRR073302	Leaf 3	0.107
	CRR073303	Juvenile bud 1	0.038
	CRR073304	Juvenile bud 2	0.099
	CRR073305	Juvenile bud 3	0.340
	CRR073306	Third green 1	0.016
	CRR073307	Third green 2	0.352
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.057
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.392
	CRR073316	Gold flowering 2	0.061
	CRR073317	Gold flowering 3	0.085
	CRR073318	Tawny withering 1	0.126
	CRR073319	Tawny withering 2	0.335
	CRR073320	Tawny withering 3	0.669