Gene detail

Detail information of GWHGAAZE027935

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AFO84070.1	1.7162E-150	alpha-amylase [Actinidia chinensis]
COG	YP_003951996.1	6E-53	alpha-amylase
Swissprot	tr\|P17859\|AMYA_VIGMU	6E-135	Alpha-amylase (Precursor)
trEMBL	tr\|S4SLG7\|S4SLG7_ACTCH	6E-151	Alpha-amylase {ECO:0000256\|RuleBase:RU361134}
TAIR10	AT4G25000.1	6E-101	alpha-amylase-like

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	32098885	32099913	+
GWHAAZE00000008	mRNA	32098885	32099913	+
GWHAAZE00000008	exon	32098885	32099017	+
GWHAAZE00000008	exon	32099273	32099913	+
GWHAAZE00000008	CDS	32098885	32099017	+
GWHAAZE00000008	CDS	32099273	32099913	+

Transcript Sequence
>GWHTAAZE027969 GGTTTTAACTGGGCATCAAATAAGAAGGAAGGAGGATGGTACAACTCACTGATGAATTCAGTCTCAGACATAGCTGCTGCTGGGGTTACCCATGTTTGGCTCCCTCCACCCTCTCAATCTGCAGCTCCCGAAGGATATTTGCCAGGAAGGTTATATGATCTCAACTCAAAATATGGGAATGAAGCCGAATTAAAAGCTTTAATTAACGCTTTCCGTAGTAAAGGTATAAAATGCATAGCTGACATAGTAATAAACCACAGAACTGCAGAGAAACAAGATAGTAGAGGGATATGGTGCATATTTGAAGGAGGGACAGCTGATGACCGTCTAGACTGGGGACCATCCCTCATTTGCAAAGACGATACGAAATACTCCAATGGCCTAGGAAACCCTGATACTGGAACCGACTTTAAGGACGCTCCCGATATTGACCATCTTAATCCTAGAGTGCGAAGAGAGTTATCCGATTGGATGAACTGGCTAAAGACAGAAATTGGATTTGCCGGGTGGCGATTTGACTTTGCTGCGGGCTACTCTCCTAGTATCACTAAGGTCTATATGCGAAAAACTTCCCCCGATTTTGCAGTCGGGGAAATCTGGAATTCACTATTGTATGAGCAAGATGAAAAACCGGCATATAACCAGGACCAACATCGTAATGAGTTGGCTCAGTGGGTCAAAAATAGCGGTGGGGTTGTGACCGCTATCGATTTCACAACCAAGGGAATTCTTCAGGCTGTCGTGAAAGGAGAATTGGGGAGAATGAAAGACTAA

Network for GWHGAAZE027935

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00128.25	Alpha-amylase	26	194	1.10E-15

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01176	AMY, amyA, malS	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Starch and sucrose metabolism	map00500
		Pancreatic secretion	map04972
		Carbohydrate digestion and absorption	map04973

Gene Ontology

GO term	Ontology	Name
GO:0005975	biological_process	carbohydrate metabolic process
GO:0003824	molecular_function	catalytic activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.516
	SRR3591706	second leaf	0.311
	SRR3591707	mature leaf	0.283
	SRR3591708	Shoot apex	0.542
	SRR3591709	Stem	3.917
	SRR3591710	White floral bud	1.180
	SRR3591711	White flower	2.242
	SRR3591712	Green floral bud	0.265
	SRR3591713	Yellow flower	1.095
SRP173429	SRR8316895	Juvenile bud stage	0.181
	SRR8316896	Juvenile bud stage	0.043
	SRR8316897	Juvenile bud stage	0.035
	SRR8316894	Third green stage	0.014
	SRR8316900	Third green stage	0.116
	SRR8316901	Third green stage	0.091
	SRR8316898	Complete white stage	0.168
	SRR8316899	Complete white stage	0.156
	SRR8316903	Complete white stage	0.287
	SRR8316902	Silver flowering stage	0.447
	SRR8316904	Silver flowering stage	0.589
	SRR8316905	Silver flowering stage	0.398
	SRR8316906	Gold flowering stage	0.438
	SRR8316907	Gold flowering stage	0.029
	SRR8316908	Gold flowering stage	0.892
SRP132670	SRR6706286	Control	0.193
	SRR6706287	Light intensity 50%	0.395
	SRR6706288	Light intensity 20%	0.115
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.090
	CNS0095593	Slightly white alabastrum(diploid) 2	0.115
	CNS0095594	Slightly white alabastrum(diploid) 3	0.054
	CNS0095595	Whole white alabastrum(diploid) 2	0.070
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.017
	CNS0095598	Silvery flower (diploied) 1	0.505
	CNS0095599	Silvery flower (diploied) 2	0.520
	CNS0095600	Silvery flower (diploied) 3	1.309
	CNS0095601	Golden flower (diploid) 1	0.445
	CNS0095602	Golden flower (diploid) 2	1.360
	CNS0095603	Golden flower (diploid) 3	1.261
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.041
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.056
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.288
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.069
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.273
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.118
	CNS0095610	Silvery flower (tetraploid) 1	2.310
	CNS0095611	Silvery flower (tetraploid) 2	2.781
	CNS0095612	Silvery flower (tetraploid) 3	1.936
	CNS0095613	Golden flower (tetraploid) 1	1.877
	CNS0095614	Golden flower (tetraploid) 2	1.193
	CNS0095615	Golden flower (tetraploid) 3	1.167
CRA001975	CRR073297	Stem 1	0.092
	CRR073298	Stem 2	0.076
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.120
	CRR073301	Leaf 2	0.188
	CRR073302	Leaf 3	0.097
	CRR073303	Juvenile bud 1	0.070
	CRR073304	Juvenile bud 2	0.130
	CRR073305	Juvenile bud 3	0.223
	CRR073306	Third green 1	0.910
	CRR073307	Third green 2	0.297
	CRR073308	Third green 3	0.511
	CRR073309	Second white 1	0.277
	CRR073310	Second white 2	0.487
	CRR073311	Second white 3	0.545
	CRR073312	Silver flowering 1	0.242
	CRR073313	Silver flowering 2	0.020
	CRR073314	Silver flowering 3	1.085
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.063
	CRR073317	Gold flowering 3	0.025
	CRR073318	Tawny withering 1	1.067
	CRR073319	Tawny withering 2	0.865
	CRR073320	Tawny withering 3	0.973