Gene detail

Detail information of GWHGAAZE027727

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010264261.1	1.93068E-48	PREDICTED: small heat shock protein, chloroplastic-like [Nelumbo nucifera]
COG	YP_007976722.1	6E-12	Small heat shock protein
Swissprot	tr\|Q39818\|HS22M_SOYBN	1E-38	Heat shock 22 kDa protein, mitochondrial (Precursor)
trEMBL	tr\|A0A068UNW6\|A0A068UNW6_COFCA	1E-44	Coffea canephora DH200=94 genomic scaffold, scaffold_41 {ECO:0000313\|EMBL:CDP09954.1}
TAIR10	AT4G25200.1	9E-26	mitochondrion-localized small heat shock protein 23.6

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	26171981	26172358	-
GWHAAZE00000008	mRNA	26171981	26172358	-
GWHAAZE00000008	exon	26171981	26172358	-
GWHAAZE00000008	CDS	26171981	26172358	-

Transcript Sequence
>GWHTAAZE027761 ATGAACCAGTTCATGGATTCTCCATTAATGGCTGCTGCTTCTCATGGAATCGGTTTTGCTGCTGGATCCAGAAGAGGACGGGACGTGAAGGAAGACAAAGAAGGTCTGCACATTCGAGTGGACATGCCTGGCCTTGACAAAAAGAATGTCAAGATATCTGTGGAGCAAAACATTCTCATCATCAAAGGAGAAGGAGAGAAGGAATCTGATGAGGAAGAGGACTATGGAAGAAGGTATTCAAGCAAGCTTGTTCTCCCCATGGATCTCTACAAGCTCAATGAGACTAAGGCTGAGATGAAAAATGGAGTCCTCAAACTTAGGGTTCCTAAGGTCAAGGAGGAAGAGAGGAAGGATGTTTTCCAAGTTAAGGTTGATTGA

Network for GWHGAAZE027727

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00011.22	HSP20	28	124	2.10E-17

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13993	HSP20	Protein processing in endoplasmic reticulum	map04141

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.113
	SRR3591706	second leaf	1.539
	SRR3591707	mature leaf	0.028
	SRR3591708	Shoot apex	1.447
	SRR3591709	Stem	0.056
	SRR3591710	White floral bud	0.849
	SRR3591711	White flower	0.648
	SRR3591712	Green floral bud	0.834
	SRR3591713	Yellow flower	0.434
SRP173429	SRR8316895	Juvenile bud stage	2.748
	SRR8316896	Juvenile bud stage	5.601
	SRR8316897	Juvenile bud stage	2.000
	SRR8316894	Third green stage	1.613
	SRR8316900	Third green stage	9.598
	SRR8316901	Third green stage	5.099
	SRR8316898	Complete white stage	0.135
	SRR8316899	Complete white stage	2.958
	SRR8316903	Complete white stage	0.909
	SRR8316902	Silver flowering stage	0.412
	SRR8316904	Silver flowering stage	0.612
	SRR8316905	Silver flowering stage	0.412
	SRR8316906	Gold flowering stage	2.381
	SRR8316907	Gold flowering stage	1.489
	SRR8316908	Gold flowering stage	2.420
SRP132670	SRR6706286	Control	4.027
	SRR6706287	Light intensity 50%	4.306
	SRR6706288	Light intensity 20%	6.703
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.914
	CNS0095593	Slightly white alabastrum(diploid) 2	6.237
	CNS0095594	Slightly white alabastrum(diploid) 3	2.621
	CNS0095595	Whole white alabastrum(diploid) 2	4.264
	CNS0095596	Whole white alabastrum(diploid) 3	5.868
	CNS0095597	Whole white alabastrum(diploid) 4	3.351
	CNS0095598	Silvery flower (diploied) 1	3.699
	CNS0095599	Silvery flower (diploied) 2	1.898
	CNS0095600	Silvery flower (diploied) 3	1.725
	CNS0095601	Golden flower (diploid) 1	3.008
	CNS0095602	Golden flower (diploid) 2	1.446
	CNS0095603	Golden flower (diploid) 3	1.059
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.649
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.435
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.581
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.357
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.763
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.860
	CNS0095610	Silvery flower (tetraploid) 1	1.178
	CNS0095611	Silvery flower (tetraploid) 2	1.929
	CNS0095612	Silvery flower (tetraploid) 3	0.316
	CNS0095613	Golden flower (tetraploid) 1	1.252
	CNS0095614	Golden flower (tetraploid) 2	1.603
	CNS0095615	Golden flower (tetraploid) 3	0.159
CRA001975	CRR073297	Stem 1	2.995
	CRR073298	Stem 2	2.500
	CRR073299	Stem 3	6.229
	CRR073300	Leaf 1	2.203
	CRR073301	Leaf 2	5.552
	CRR073302	Leaf 3	8.870
	CRR073303	Juvenile bud 1	5.200
	CRR073304	Juvenile bud 2	3.141
	CRR073305	Juvenile bud 3	4.345
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.055
	CRR073310	Second white 2	1.324
	CRR073311	Second white 3	1.290
	CRR073312	Silver flowering 1	0.247
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	5.796
	CRR073316	Gold flowering 2	2.671
	CRR073317	Gold flowering 3	3.153
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.011
	CRR073320	Tawny withering 3	0.000