Gene detail

Detail information of GWHGAAZE027638

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006440494.1	2.65101E-69	hypothetical protein CICLE_v10021651mg [Citrus clementina]
Swissprot	tr\|Q66WT5\|SGR2_ARATH	2E-46	Protein STAY-GREEN 2, chloroplastic (Precursor)
trEMBL	tr\|V4VLU2\|V4VLU2_9ROSI	1E-69	Uncharacterized protein {ECO:0000313\|EMBL:ESR53734.1}
TAIR10	AT4G11910.1	5E-39	Without detailed annotation

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	24311479	24314451	+
GWHAAZE00000008	mRNA	24311479	24314451	+
GWHAAZE00000008	exon	24311479	24311604	+
GWHAAZE00000008	exon	24312020	24312193	+
GWHAAZE00000008	exon	24314125	24314451	+
GWHAAZE00000008	CDS	24311479	24311604	+
GWHAAZE00000008	CDS	24312020	24312193	+
GWHAAZE00000008	CDS	24314125	24314451	+

Transcript Sequence
>GWHTAAZE027672 ATGCCTGCTTTAACCACTTCTCTCCTTCCCTCAAAGCTCAACCCTCACTCCCTCTCTCGACACCCATCCTCTGTTATCCTTTACACAACTAGTACAAGCTCCAACAAGAACAACCACTACTCCATAGTTTCAAGATTATATGGGCCGGCTATATTTGAAGAATCAAAGCTAAGGGTTATATTTTCAGGAGTTGATGAAAAGATGCACCCAGCGAAGCTTCCAAGAACTTACACACTTACACATTGTGATGTGACCTCTAAGCTCACTCTTGCTATCTCTCAAACCATAAATAATTCTCAGGTATTGAAGGCATTTGTTCATGGAGATGGGAAATTGCTAAGGAATTACCCAGAATTAGAAGAAGCTTTGGTGTGGGTTTATTTTCACTCAAATATTCCTCAATACAACAAGGTGGACTGCTGGGGTCCACTTAAAGATGCCCCAGTCAAAATTGGAAAAGAGAAGCAAGAAGAAAGAGCTCCATCAACCAATTGGGAAAGAATTCCACAATCATGCGAAGGGCCATGCTCTTGTTGCTTCACACCAATGAGCTTCATCAATTGGGACCCACAAGGTGGGCCTAGTGGGACCCACAAAAACTTGACGACAGCAGACATGAAAACATGA

Network for GWHGAAZE027638

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF12638.8	Staygreen	52	101	1.90E-11
PF12638.8	Staygreen	101	147	7.30E-16

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K22013	SGR, SGRL	Biosynthesis of secondary metabolites	map01110
K22013	SGR, SGRL	Porphyrin and chlorophyll metabolism	map00860

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.480
	SRR3591706	second leaf	1.480
	SRR3591707	mature leaf	15.755
	SRR3591708	Shoot apex	2.876
	SRR3591709	Stem	2.328
	SRR3591710	White floral bud	9.839
	SRR3591711	White flower	76.440
	SRR3591712	Green floral bud	0.286
	SRR3591713	Yellow flower	79.889
SRP173429	SRR8316895	Juvenile bud stage	0.137
	SRR8316896	Juvenile bud stage	0.254
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.081
	SRR8316901	Third green stage	0.450
	SRR8316898	Complete white stage	2.049
	SRR8316899	Complete white stage	0.605
	SRR8316903	Complete white stage	2.946
	SRR8316902	Silver flowering stage	15.136
	SRR8316904	Silver flowering stage	19.394
	SRR8316905	Silver flowering stage	5.619
	SRR8316906	Gold flowering stage	43.915
	SRR8316907	Gold flowering stage	38.691
	SRR8316908	Gold flowering stage	35.110
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.025
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.142
	CNS0095594	Slightly white alabastrum(diploid) 3	0.169
	CNS0095595	Whole white alabastrum(diploid) 2	0.056
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.045
	CNS0095598	Silvery flower (diploied) 1	0.542
	CNS0095599	Silvery flower (diploied) 2	1.963
	CNS0095600	Silvery flower (diploied) 3	6.384
	CNS0095601	Golden flower (diploid) 1	0.512
	CNS0095602	Golden flower (diploid) 2	1.793
	CNS0095603	Golden flower (diploid) 3	1.520
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.325
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.568
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.295
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.174
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.082
	CNS0095610	Silvery flower (tetraploid) 1	15.168
	CNS0095611	Silvery flower (tetraploid) 2	2.170
	CNS0095612	Silvery flower (tetraploid) 3	20.069
	CNS0095613	Golden flower (tetraploid) 1	9.800
	CNS0095614	Golden flower (tetraploid) 2	2.081
	CNS0095615	Golden flower (tetraploid) 3	14.211
CRA001975	CRR073297	Stem 1	0.280
	CRR073298	Stem 2	0.174
	CRR073299	Stem 3	0.063
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.120
	CRR073303	Juvenile bud 1	0.168
	CRR073304	Juvenile bud 2	0.203
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	12.336
	CRR073307	Third green 2	13.534
	CRR073308	Third green 3	19.433
	CRR073309	Second white 1	35.788
	CRR073310	Second white 2	34.951
	CRR073311	Second white 3	37.172
	CRR073312	Silver flowering 1	30.697
	CRR073313	Silver flowering 2	15.295
	CRR073314	Silver flowering 3	18.523
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.267
	CRR073318	Tawny withering 1	2.815
	CRR073319	Tawny withering 2	1.502
	CRR073320	Tawny withering 3	3.888