Gene detail

Detail information of GWHGAAZE027592

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006439576.1	2.35572E-84	hypothetical protein CICLE_v10023304mg [Citrus clementina]
Swissprot	tr\|Q6EUH7\|ADF1_ORYSJ	3E-83	Actin-depolymerizing factor 1
trEMBL	tr\|V4TSD2\|V4TSD2_9ROSI	9E-85	Uncharacterized protein {ECO:0000313\|EMBL:ESR52816.1}
TAIR10	AT1G01750.1	5E-65	actin depolymerizing factor 11

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	23252662	23253561	+
GWHAAZE00000008	mRNA	23252662	23253561	+
GWHAAZE00000008	exon	23252662	23252927	+
GWHAAZE00000008	exon	23253300	23253561	+
GWHAAZE00000008	CDS	23252662	23252927	+
GWHAAZE00000008	CDS	23253300	23253561	+

Transcript Sequence
>GWHTAAZE027626 GCGAACTCTGCATCTGGAATGGCCGTGAACGATGAGTGTAAGCTGAAGTTTTTGGAGCTGAAAGCGAAGAGGAACTACCGATACATTATATTCAAGATCAACGAAGCTATTCAGCAGGTGGCAGTTGAGAAGGTTGGAAATCCTGGCGACAGCTACGAGGATTTCACCTCCAGCTTGCCCCTTGACGAGTGTCGTTATGCTGTCTACGATTTTGATTTCACTACTGATGAGAACTGCCAGAAAAGCAAAATTTTCTTCGTTGCATGGGCCCCTGATACATCGAAGGTGAGGAGTAAGATGGTGTATGCTAGTTCCAAGGATAGGTTCAAGAGAGAACTGGATGGGATTCAAGTTGAACTGCAAGCAACAGATCCCAGTGAGATGAGCCTTGACATTGTTAAGGCTCGAGCCATTTAATTTATTTATTATGTTTTTAAACTTATATAATATATATATTTATTTATTTATAGCATTAATTTGTTGTTTGTGCTTTTATTTGCCAAACACTGCTTTATGTCTTTCATTTGA

Network for GWHGAAZE027592

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00241.21	Cofilin_ADF	13	135	1.40E-37

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K05765	CFL	Regulation of actin cytoskeleton	map04810
		Fc gamma R-mediated phagocytosis	map04666
		Axon guidance	map04360

Gene Ontology

GO term	Ontology	Name
GO:0030042	biological_process	actin filament depolymerization
GO:0015629	cellular_component	actin cytoskeleton
GO:0003779	molecular_function	actin binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.289
	SRR3591706	second leaf	0.102
	SRR3591707	mature leaf	0.119
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.466
	SRR3591710	White floral bud	83.513
	SRR3591711	White flower	6.851
	SRR3591712	Green floral bud	85.154
	SRR3591713	Yellow flower	5.834
SRP173429	SRR8316895	Juvenile bud stage	1.200
	SRR8316896	Juvenile bud stage	29.841
	SRR8316897	Juvenile bud stage	42.908
	SRR8316894	Third green stage	24.094
	SRR8316900	Third green stage	122.209
	SRR8316901	Third green stage	120.841
	SRR8316898	Complete white stage	0.452
	SRR8316899	Complete white stage	1.996
	SRR8316903	Complete white stage	0.821
	SRR8316902	Silver flowering stage	4.545
	SRR8316904	Silver flowering stage	4.531
	SRR8316905	Silver flowering stage	1.935
	SRR8316906	Gold flowering stage	4.088
	SRR8316907	Gold flowering stage	11.436
	SRR8316908	Gold flowering stage	3.887
SRP132670	SRR6706286	Control	71.481
	SRR6706287	Light intensity 50%	70.296
	SRR6706288	Light intensity 20%	74.686
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	92.789
	CNS0095593	Slightly white alabastrum(diploid) 2	74.232
	CNS0095594	Slightly white alabastrum(diploid) 3	104.039
	CNS0095595	Whole white alabastrum(diploid) 2	168.497
	CNS0095596	Whole white alabastrum(diploid) 3	210.355
	CNS0095597	Whole white alabastrum(diploid) 4	200.384
	CNS0095598	Silvery flower (diploied) 1	12.065
	CNS0095599	Silvery flower (diploied) 2	44.470
	CNS0095600	Silvery flower (diploied) 3	12.215
	CNS0095601	Golden flower (diploid) 1	16.206
	CNS0095602	Golden flower (diploid) 2	6.688
	CNS0095603	Golden flower (diploid) 3	8.078
	CNS0095604	Slightly white alabastrum(tetraploid) 1	173.058
	CNS0095605	Slightly white alabastrum(tetraploid) 2	135.093
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.664
	CNS0095607	Whole white alabastrum(tetraploid) 1	299.973
	CNS0095608	Whole white alabastrum(tetraploid) 2	364.649
	CNS0095609	Whole white alabastrum(tetraploid) 3	214.621
	CNS0095610	Silvery flower (tetraploid) 1	13.180
	CNS0095611	Silvery flower (tetraploid) 2	26.372
	CNS0095612	Silvery flower (tetraploid) 3	39.024
	CNS0095613	Golden flower (tetraploid) 1	15.044
	CNS0095614	Golden flower (tetraploid) 2	5.553
	CNS0095615	Golden flower (tetraploid) 3	35.595
CRA001975	CRR073297	Stem 1	17.407
	CRR073298	Stem 2	24.993
	CRR073299	Stem 3	16.170
	CRR073300	Leaf 1	73.743
	CRR073301	Leaf 2	65.528
	CRR073302	Leaf 3	61.390
	CRR073303	Juvenile bud 1	79.627
	CRR073304	Juvenile bud 2	96.014
	CRR073305	Juvenile bud 3	8.944
	CRR073306	Third green 1	71.550
	CRR073307	Third green 2	97.639
	CRR073308	Third green 3	75.414
	CRR073309	Second white 1	21.692
	CRR073310	Second white 2	24.080
	CRR073311	Second white 3	21.346
	CRR073312	Silver flowering 1	72.045
	CRR073313	Silver flowering 2	85.098
	CRR073314	Silver flowering 3	45.173
	CRR073315	Gold flowering 1	71.307
	CRR073316	Gold flowering 2	17.492
	CRR073317	Gold flowering 3	40.043
	CRR073318	Tawny withering 1	59.441
	CRR073319	Tawny withering 2	46.881
	CRR073320	Tawny withering 3	50.546