Gene detail

Detail information of GWHGAAZE027582

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010249803.1	1.43065E-84	PREDICTED: actin-depolymerizing factor [Nelumbo nucifera]
Swissprot	tr\|Q6EUH7\|ADF1_ORYSJ	8E-84	Actin-depolymerizing factor 1
trEMBL	tr\|V4TSD2\|V4TSD2_9ROSI	7E-85	Uncharacterized protein {ECO:0000313\|EMBL:ESR52816.1}
TAIR10	AT1G01750.1	7E-65	actin depolymerizing factor 11

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	22943226	22944082	+
GWHAAZE00000008	mRNA	22943226	22944082	+
GWHAAZE00000008	exon	22943226	22943491	+
GWHAAZE00000008	exon	22943869	22944082	+
GWHAAZE00000008	CDS	22943226	22943491	+
GWHAAZE00000008	CDS	22943869	22944082	+

Transcript Sequence
>GWHTAAZE027616 GCGAACTCTGCATCTGGAATGGCCGTGAACGATGAGTGTAAGCTGAAGTTTTTGGAGCTGAAAGCGAAGAGGAACTACCGATACATTATATTCAAGATCAACGAAGCTATTCAGCAGGTGGCAGTTGAGAAGGTTGGAAATCCTGGCGACAGCTACGAGGATTTCACCTCCAGCTTGCCCCTTGACGAGTGTCGTTATGCTGTCTACGATTTTGATTTCACTACTGATGAGAACTGCCAGAAAAGCAAAATTTTCTTCGTTGCATGGGCCCCTGATACATCAAAGGTGAGGAGTAAGATGGTGTATGCTAGTTCCAAGGATAGGTTCAAGAGAGAACTGGATGGGATTCAAGTTGAACTGCAAGCAACAGATCCCAGTGAGATGAGCCTTGACATTGTTAAGGCTCGAGCCATTTAATTTATTTATTATGTTTTTAAACTTATATAATATATATATATATTTATTTATTTATAGCATTAA

Network for GWHGAAZE027582

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00241.21	Cofilin_ADF	13	135	1.00E-37

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K05765	CFL	Regulation of actin cytoskeleton	map04810
		Fc gamma R-mediated phagocytosis	map04666
		Axon guidance	map04360

Gene Ontology

GO term	Ontology	Name
GO:0030042	biological_process	actin filament depolymerization
GO:0015629	cellular_component	actin cytoskeleton
GO:0003779	molecular_function	actin binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.472
	SRR3591706	second leaf	0.325
	SRR3591707	mature leaf	0.131
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	2.865
	SRR3591710	White floral bud	264.445
	SRR3591711	White flower	19.039
	SRR3591712	Green floral bud	252.794
	SRR3591713	Yellow flower	26.767
SRP173429	SRR8316895	Juvenile bud stage	1.319
	SRR8316896	Juvenile bud stage	45.363
	SRR8316897	Juvenile bud stage	20.919
	SRR8316894	Third green stage	30.738
	SRR8316900	Third green stage	163.204
	SRR8316901	Third green stage	199.078
	SRR8316898	Complete white stage	1.593
	SRR8316899	Complete white stage	1.154
	SRR8316903	Complete white stage	1.093
	SRR8316902	Silver flowering stage	11.806
	SRR8316904	Silver flowering stage	13.997
	SRR8316905	Silver flowering stage	4.520
	SRR8316906	Gold flowering stage	15.375
	SRR8316907	Gold flowering stage	27.001
	SRR8316908	Gold flowering stage	7.085
SRP132670	SRR6706286	Control	104.292
	SRR6706287	Light intensity 50%	114.809
	SRR6706288	Light intensity 20%	100.388
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	90.522
	CNS0095593	Slightly white alabastrum(diploid) 2	66.228
	CNS0095594	Slightly white alabastrum(diploid) 3	97.417
	CNS0095595	Whole white alabastrum(diploid) 2	153.725
	CNS0095596	Whole white alabastrum(diploid) 3	224.217
	CNS0095597	Whole white alabastrum(diploid) 4	159.990
	CNS0095598	Silvery flower (diploied) 1	18.045
	CNS0095599	Silvery flower (diploied) 2	61.917
	CNS0095600	Silvery flower (diploied) 3	19.114
	CNS0095601	Golden flower (diploid) 1	21.478
	CNS0095602	Golden flower (diploid) 2	16.610
	CNS0095603	Golden flower (diploid) 3	12.765
	CNS0095604	Slightly white alabastrum(tetraploid) 1	203.836
	CNS0095605	Slightly white alabastrum(tetraploid) 2	239.344
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.270
	CNS0095607	Whole white alabastrum(tetraploid) 1	406.152
	CNS0095608	Whole white alabastrum(tetraploid) 2	550.783
	CNS0095609	Whole white alabastrum(tetraploid) 3	282.096
	CNS0095610	Silvery flower (tetraploid) 1	17.681
	CNS0095611	Silvery flower (tetraploid) 2	34.196
	CNS0095612	Silvery flower (tetraploid) 3	71.770
	CNS0095613	Golden flower (tetraploid) 1	28.241
	CNS0095614	Golden flower (tetraploid) 2	8.858
	CNS0095615	Golden flower (tetraploid) 3	49.543
CRA001975	CRR073297	Stem 1	19.824
	CRR073298	Stem 2	34.093
	CRR073299	Stem 3	19.173
	CRR073300	Leaf 1	91.114
	CRR073301	Leaf 2	81.851
	CRR073302	Leaf 3	76.338
	CRR073303	Juvenile bud 1	95.785
	CRR073304	Juvenile bud 2	130.020
	CRR073305	Juvenile bud 3	11.736
	CRR073306	Third green 1	94.212
	CRR073307	Third green 2	147.257
	CRR073308	Third green 3	98.653
	CRR073309	Second white 1	38.914
	CRR073310	Second white 2	47.383
	CRR073311	Second white 3	38.291
	CRR073312	Silver flowering 1	117.359
	CRR073313	Silver flowering 2	129.299
	CRR073314	Silver flowering 3	89.315
	CRR073315	Gold flowering 1	82.470
	CRR073316	Gold flowering 2	26.114
	CRR073317	Gold flowering 3	43.125
	CRR073318	Tawny withering 1	71.138
	CRR073319	Tawny withering 2	71.383
	CRR073320	Tawny withering 3	70.123