Gene detail

Detail information of GWHGAAZE027527

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP12079.1	1.6571E-27	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9FFS3\|WRK24_ARATH	4E-17	Probable WRKY transcription factor 24
trEMBL	tr\|A0A068UUY2\|A0A068UUY2_COFCA	6E-28	Coffea canephora DH200=94 genomic scaffold, scaffold_62 {ECO:0000313\|EMBL:CDP12079.1}
TAIR10	AT5G41570.1	2E-13	WRKY DNA-binding protein 24

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	21563018	21563467	-
GWHAAZE00000008	mRNA	21563018	21563467	-
GWHAAZE00000008	exon	21563018	21563467	-
GWHAAZE00000008	CDS	21563018	21563467	-

Transcript Sequence
>GWHTAAZE027561 CCACTAGAAAACTACGACAATAATCCCTACTTCTTCACACCTTCTCTATCATCACCTTCTCCCTTTCTCTCCCCTCCATTCTCACTAAACCAAGAACCCCCCATTAATATCCAAACCTCTCAAAATGGCGGGTTCGATAATATCGACTGGGTTAGCCTCCTCTCGGGCGATGGTGGGACCCGCCAAAGACTGCCATCTCCGGCACAAATTACGAGTAATATTGTGGGTAATGGTAATCATGAAGGAGAAAGTGGTGGTGGTGGTGGTGCTGCTGCTGCTGCTGCTGCTGGTAGAAATAAAGGAGGGATATTGAGGACAAGTAGGACCAAGAAATCTGTGCCTCCTAGGGTTGCATTTCATACTAGGAGTTCGGAAGATATTCTCGATGATGGTTACAAGTGGCGTAAGTATGGGCAGAAGTCTGTCAAGAATAATGTTCACCCCAGGTAA

Network for GWHGAAZE027527

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03106.16	WRKY	129	149	1.80E-06

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	WRKY

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0043565	molecular_function	sequence-specific DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.469
	SRR3591709	Stem	0.275
	SRR3591710	White floral bud	2.211
	SRR3591711	White flower	0.516
	SRR3591712	Green floral bud	0.237
	SRR3591713	Yellow flower	0.769
SRP173429	SRR8316895	Juvenile bud stage	4.142
	SRR8316896	Juvenile bud stage	5.823
	SRR8316897	Juvenile bud stage	1.429
	SRR8316894	Third green stage	1.233
	SRR8316900	Third green stage	4.354
	SRR8316901	Third green stage	3.725
	SRR8316898	Complete white stage	1.573
	SRR8316899	Complete white stage	4.755
	SRR8316903	Complete white stage	4.070
	SRR8316902	Silver flowering stage	1.712
	SRR8316904	Silver flowering stage	1.310
	SRR8316905	Silver flowering stage	0.517
	SRR8316906	Gold flowering stage	0.799
	SRR8316907	Gold flowering stage	1.798
	SRR8316908	Gold flowering stage	0.455
SRP132670	SRR6706286	Control	1.751
	SRR6706287	Light intensity 50%	0.988
	SRR6706288	Light intensity 20%	1.644
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	10.653
	CNS0095593	Slightly white alabastrum(diploid) 2	7.727
	CNS0095594	Slightly white alabastrum(diploid) 3	7.845
	CNS0095595	Whole white alabastrum(diploid) 2	5.575
	CNS0095596	Whole white alabastrum(diploid) 3	4.488
	CNS0095597	Whole white alabastrum(diploid) 4	3.430
	CNS0095598	Silvery flower (diploied) 1	4.647
	CNS0095599	Silvery flower (diploied) 2	3.981
	CNS0095600	Silvery flower (diploied) 3	2.198
	CNS0095601	Golden flower (diploid) 1	1.739
	CNS0095602	Golden flower (diploid) 2	0.656
	CNS0095603	Golden flower (diploid) 3	0.797
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.195
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.707
	CNS0095606	Slightly white alabastrum(tetraploid) 3	8.744
	CNS0095607	Whole white alabastrum(tetraploid) 1	5.580
	CNS0095608	Whole white alabastrum(tetraploid) 2	7.720
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.705
	CNS0095610	Silvery flower (tetraploid) 1	2.532
	CNS0095611	Silvery flower (tetraploid) 2	1.928
	CNS0095612	Silvery flower (tetraploid) 3	1.442
	CNS0095613	Golden flower (tetraploid) 1	1.512
	CNS0095614	Golden flower (tetraploid) 2	0.468
	CNS0095615	Golden flower (tetraploid) 3	0.487
CRA001975	CRR073297	Stem 1	7.396
	CRR073298	Stem 2	6.360
	CRR073299	Stem 3	0.555
	CRR073300	Leaf 1	4.818
	CRR073301	Leaf 2	7.335
	CRR073302	Leaf 3	0.767
	CRR073303	Juvenile bud 1	1.160
	CRR073304	Juvenile bud 2	0.414
	CRR073305	Juvenile bud 3	2.542
	CRR073306	Third green 1	0.416
	CRR073307	Third green 2	1.972
	CRR073308	Third green 3	0.642
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.177
	CRR073311	Second white 3	0.280
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	1.101
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.214
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	4.546
	CRR073319	Tawny withering 2	0.125
	CRR073320	Tawny withering 3	7.114