Gene detail

Detail information of GWHGAAZE027496

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006439361.1	1.05435E-86	hypothetical protein CICLE_v10021265mg [Citrus clementina]
Swissprot	tr\|Q9C7W2\|ERF61_ARATH	3E-61	Ethylene-responsive transcription factor ERF061
trEMBL	tr\|V4TRS1\|V4TRS1_9ROSI	4E-87	Uncharacterized protein {ECO:0000313\|EMBL:ESR52601.1}
TAIR10	AT1G64380.1	1E-50	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	20889954	20890691	+
GWHAAZE00000008	mRNA	20889954	20890691	+
GWHAAZE00000008	exon	20889954	20890691	+
GWHAAZE00000008	CDS	20889954	20890691	+

Transcript Sequence
>GWHTAAZE027530 ATGGATTCAATTTTCTCCCATTGCTCAATTTCACCCACCATCACAAACCCCATTACAGAGCCATTAGGCTCTTCGGTATACCTTAAACAAAGAGACTTGCTCCAAAAATTCTGCCTAGAAAACAGACCCATATCATCACAATTCCCATGTACCACCTATTTTGTTCCACCTAAGAAAAAGCTATACAGGGGAGTGAGACAGAGGCAATGGGGGAAATGGGTAGCTGAAATTAGACTCCCACAGAATCGAATGAGGGTTTGGTTAGGTACTTACGAATCAGCCGAGGCTGCAGCCTATGCTTACGATAGAGCCGCGTACAAGCTGCGTGGAGAATACGCGCGGTTGAATTTCCCAAATCTTGGGGATCCCAGCAACTTAGGATTTTTTGGTGATGGTGAGAGATTGAATGCTTTAAAGAGGGCGGTGGATCACAAGATTGAATCCATTTGCCAGAAAGTGAGGAGAGAGAAAGGTAAGAAGGTGAAGAATAGTGAGAAGGTGGAGAAGATTGAGACTAGTTCCGTTACGACGTCGTGCTCGTTAGGAGGTAATGGTAGTTCGAGTAATGAAATGGTGTCGTCTTGTGAAGAGGGGTTTTGGAAGGGGGAGAATTCAGGGGGTTGTGTTTCTGGCGAGTTTCCGGCGGTGGTGACGGAGGAATCGGAGTTTGAAGGTTGTTCGCTTGCTCGTATGCCGTCGTTTGATCCTGAGCTGATCTGGGAGGTTCTGGCTAGCTAG

Network for GWHGAAZE027496

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	62	111	4.20E-13

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding
GO:0003700	molecular_function	DNA-binding transcription factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.230
	SRR3591706	second leaf	0.242
	SRR3591707	mature leaf	0.312
	SRR3591708	Shoot apex	0.231
	SRR3591709	Stem	0.597
	SRR3591710	White floral bud	0.535
	SRR3591711	White flower	9.733
	SRR3591712	Green floral bud	1.024
	SRR3591713	Yellow flower	1.850
SRP173429	SRR8316895	Juvenile bud stage	0.056
	SRR8316896	Juvenile bud stage	0.422
	SRR8316897	Juvenile bud stage	0.129
	SRR8316894	Third green stage	0.513
	SRR8316900	Third green stage	1.705
	SRR8316901	Third green stage	0.769
	SRR8316898	Complete white stage	0.580
	SRR8316899	Complete white stage	0.326
	SRR8316903	Complete white stage	0.139
	SRR8316902	Silver flowering stage	1.894
	SRR8316904	Silver flowering stage	1.812
	SRR8316905	Silver flowering stage	1.070
	SRR8316906	Gold flowering stage	7.255
	SRR8316907	Gold flowering stage	2.214
	SRR8316908	Gold flowering stage	1.876
SRP132670	SRR6706286	Control	1.986
	SRR6706287	Light intensity 50%	1.425
	SRR6706288	Light intensity 20%	0.893
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.693
	CNS0095593	Slightly white alabastrum(diploid) 2	1.277
	CNS0095594	Slightly white alabastrum(diploid) 3	0.603
	CNS0095595	Whole white alabastrum(diploid) 2	0.585
	CNS0095596	Whole white alabastrum(diploid) 3	1.031
	CNS0095597	Whole white alabastrum(diploid) 4	0.343
	CNS0095598	Silvery flower (diploied) 1	1.618
	CNS0095599	Silvery flower (diploied) 2	1.011
	CNS0095600	Silvery flower (diploied) 3	1.676
	CNS0095601	Golden flower (diploid) 1	0.166
	CNS0095602	Golden flower (diploid) 2	0.757
	CNS0095603	Golden flower (diploid) 3	0.404
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.556
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.930
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.027
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.332
	CNS0095610	Silvery flower (tetraploid) 1	1.064
	CNS0095611	Silvery flower (tetraploid) 2	0.063
	CNS0095612	Silvery flower (tetraploid) 3	0.201
	CNS0095613	Golden flower (tetraploid) 1	0.054
	CNS0095614	Golden flower (tetraploid) 2	0.691
	CNS0095615	Golden flower (tetraploid) 3	0.176
CRA001975	CRR073297	Stem 1	1.062
	CRR073298	Stem 2	1.917
	CRR073299	Stem 3	0.229
	CRR073300	Leaf 1	3.021
	CRR073301	Leaf 2	3.648
	CRR073302	Leaf 3	2.188
	CRR073303	Juvenile bud 1	0.778
	CRR073304	Juvenile bud 2	0.492
	CRR073305	Juvenile bud 3	1.015
	CRR073306	Third green 1	0.823
	CRR073307	Third green 2	0.252
	CRR073308	Third green 3	0.996
	CRR073309	Second white 1	1.693
	CRR073310	Second white 2	1.924
	CRR073311	Second white 3	0.590
	CRR073312	Silver flowering 1	0.096
	CRR073313	Silver flowering 2	0.188
	CRR073314	Silver flowering 3	0.004
	CRR073315	Gold flowering 1	0.240
	CRR073316	Gold flowering 2	0.135
	CRR073317	Gold flowering 3	0.024
	CRR073318	Tawny withering 1	1.521
	CRR073319	Tawny withering 2	0.406
	CRR073320	Tawny withering 3	0.955