Gene detail

Detail information of GWHGAAZE027415

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006439361.1	1.05435E-86	hypothetical protein CICLE_v10021265mg [Citrus clementina]
Swissprot	tr\|Q9C7W2\|ERF61_ARATH	3E-61	Ethylene-responsive transcription factor ERF061
trEMBL	tr\|V4TRS1\|V4TRS1_9ROSI	4E-87	Uncharacterized protein {ECO:0000313\|EMBL:ESR52601.1}
TAIR10	AT1G64380.1	1E-50	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	19484878	19485615	-
GWHAAZE00000008	mRNA	19484878	19485615	-
GWHAAZE00000008	exon	19484878	19485615	-
GWHAAZE00000008	CDS	19484878	19485615	-

Transcript Sequence
>GWHTAAZE027449 ATGGATTCAATTTTCTCCCATTGCTCAATTTCACCCACCATCACAAACCCCATTACAGAGCCATTAGGCTCTTCGGTATACCTTAAACAAAGAGACTTGCTCCAAAAATTCTGCCTAGAAAATAGACCCATATCATCACAATTCCCATGTACCACCTATTTTGTTCCACCTAAGAAAAAGCTATACAGGGGAGTGAGACAGAGGCAATGGGGGAAATGGGTAGCTGAAATTAGACTCCCACAGAATCGAATGAGGGTTTGGTTAGGTACTTACGAATCAGCCGAGGCTGCAGCCTATGCTTACGATAGAGCCGCGTACAAGCTGCGTGGAGAATACGCGCGGTTGAATTTCCCAAATCTTGGGGATCCCAGCAACTTAGGATTTTTTGGTGATGGTGAGAGATTGAATGCTTTAAAGAGGGCGGTGGATCACAAGATTGAATCCATTTGCCAGAAAGTGAGGAGAGAGAAAGGTAAGAAGGTGAAGAATAGTGAGAAGGTGGAGAAGATTGAGACTAGTTCCGTTACGACGTCGTGCTCGTTAGGAGGTAATGGTAGTTCGAGTAATGAAATGGTGTCGTCTTGTGAAGAGGGGTTTTGGAAGGGGGAGAATTCAGGGGGTTGTGTTTCTGGCGAGTTTCCGGCGGTGGTGACGGAGGAATCGGAGTTTGAAGGTTGTTCGCTTGCTCGTATGCCGTCGTTTGATCCTGAGCTGATCTGGGAGGTTCTGGCTAGCTAG

Network for GWHGAAZE027415

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	62	111	4.20E-13

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding
GO:0003700	molecular_function	DNA-binding transcription factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.102
	SRR3591706	second leaf	0.415
	SRR3591707	mature leaf	0.372
	SRR3591708	Shoot apex	0.216
	SRR3591709	Stem	0.629
	SRR3591710	White floral bud	0.254
	SRR3591711	White flower	5.176
	SRR3591712	Green floral bud	0.552
	SRR3591713	Yellow flower	1.051
SRP173429	SRR8316895	Juvenile bud stage	0.056
	SRR8316896	Juvenile bud stage	0.332
	SRR8316897	Juvenile bud stage	0.199
	SRR8316894	Third green stage	0.490
	SRR8316900	Third green stage	1.984
	SRR8316901	Third green stage	0.845
	SRR8316898	Complete white stage	0.305
	SRR8316899	Complete white stage	0.233
	SRR8316903	Complete white stage	0.139
	SRR8316902	Silver flowering stage	1.686
	SRR8316904	Silver flowering stage	2.098
	SRR8316905	Silver flowering stage	1.205
	SRR8316906	Gold flowering stage	8.603
	SRR8316907	Gold flowering stage	2.586
	SRR8316908	Gold flowering stage	2.624
SRP132670	SRR6706286	Control	2.175
	SRR6706287	Light intensity 50%	1.282
	SRR6706288	Light intensity 20%	0.925
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.991
	CNS0095593	Slightly white alabastrum(diploid) 2	1.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.722
	CNS0095595	Whole white alabastrum(diploid) 2	0.541
	CNS0095596	Whole white alabastrum(diploid) 3	0.685
	CNS0095597	Whole white alabastrum(diploid) 4	0.219
	CNS0095598	Silvery flower (diploied) 1	1.194
	CNS0095599	Silvery flower (diploied) 2	0.577
	CNS0095600	Silvery flower (diploied) 3	1.082
	CNS0095601	Golden flower (diploid) 1	0.044
	CNS0095602	Golden flower (diploid) 2	0.440
	CNS0095603	Golden flower (diploid) 3	0.296
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.868
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.040
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.049
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.059
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.148
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.581
	CNS0095610	Silvery flower (tetraploid) 1	3.230
	CNS0095611	Silvery flower (tetraploid) 2	0.439
	CNS0095612	Silvery flower (tetraploid) 3	0.726
	CNS0095613	Golden flower (tetraploid) 1	0.183
	CNS0095614	Golden flower (tetraploid) 2	1.013
	CNS0095615	Golden flower (tetraploid) 3	0.312
CRA001975	CRR073297	Stem 1	1.456
	CRR073298	Stem 2	2.363
	CRR073299	Stem 3	0.222
	CRR073300	Leaf 1	4.010
	CRR073301	Leaf 2	3.607
	CRR073302	Leaf 3	2.187
	CRR073303	Juvenile bud 1	1.125
	CRR073304	Juvenile bud 2	0.692
	CRR073305	Juvenile bud 3	1.008
	CRR073306	Third green 1	0.749
	CRR073307	Third green 2	0.198
	CRR073308	Third green 3	0.892
	CRR073309	Second white 1	2.319
	CRR073310	Second white 2	1.080
	CRR073311	Second white 3	0.329
	CRR073312	Silver flowering 1	0.096
	CRR073313	Silver flowering 2	0.188
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.396
	CRR073316	Gold flowering 2	0.376
	CRR073317	Gold flowering 3	0.128
	CRR073318	Tawny withering 1	0.770
	CRR073319	Tawny withering 2	0.770
	CRR073320	Tawny withering 3	1.430