Gene detail

Detail information of GWHGAAZE027362

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009620231.1	7.9361E-104	PREDICTED: ubiquitin-conjugating enzyme E2 28 [Nicotiana tomentosiformis]
COG	YP_008797956.1	2E-23	ubiquitin-conjugating enzyme E2-like protein
Swissprot	tr\|P35135\|UBC4_SOLLC	2E-103	Ubiquitin-conjugating enzyme E2-17 kDa
trEMBL	tr\|M1C0T1\|M1C0T1_SOLTU	6E-104	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400057302}
TAIR10	AT1G64230.2	1E-80	ubiquitin-conjugating enzyme 28

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	18280524	18282845	+
GWHAAZE00000008	mRNA	18280524	18282845	+
GWHAAZE00000008	exon	18280524	18280593	+
GWHAAZE00000008	exon	18281887	18282014	+
GWHAAZE00000008	exon	18282428	18282532	+
GWHAAZE00000008	exon	18282702	18282845	+
GWHAAZE00000008	CDS	18280524	18280593	+
GWHAAZE00000008	CDS	18281887	18282014	+
GWHAAZE00000008	CDS	18282428	18282532	+
GWHAAZE00000008	CDS	18282702	18282845	+

Transcript Sequence
>GWHTAAZE027396 ATGGCATCGAAGAGGATTCAGAAAGAGCTAAAAGACTTACAGAAGGACCCTCCTGCATCTTGTAGCGCCGGCCCTGTTGGTGAGGACATGTTCCATTGGCAAGCAACAATTATGGGCCCATCAGACAGTCCTTTCACTGGTGGCGTGTTTCTTGTATCCATTCATTTCCCACCGGATTATCCATTCAAGCCTCCAAAGGTTTCCTTCCGCACCAAAGTATTCCACCCAAATATAAACAGCAACGGTAGCATCTGCCTTGATATCCTCAAAGAGCAGTGGAGCCCTGCTCTAACAATATCCAAGGTGCTGCTTTCAATATGCTCGTTGTTGACAGATCCGAATCCAGATGATCCCCTGGTGCCGGAGATTGCTCATATGTACAAGACGGATAGAATCAAGTATGAGACCACCGCTCGCTCTTGGACCCAGAAGTATGCCATGGGGTAA

Network for GWHGAAZE027362

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00179.27	UQ_con	5	141	7.70E-53

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	UBC

KEGG pathway

KO	Enzyme	pathway	mapID
K06689	UBE2D, UBC4, UBC5	Protein processing in endoplasmic reticulum	map04141
		Ubiquitin mediated proteolysis	map04120
		MAPK signaling pathway - fly	map04013
		Toll and Imd signaling pathway	map04624

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	25.203
	SRR3591706	second leaf	24.274
	SRR3591707	mature leaf	49.930
	SRR3591708	Shoot apex	37.505
	SRR3591709	Stem	71.673
	SRR3591710	White floral bud	106.189
	SRR3591711	White flower	151.507
	SRR3591712	Green floral bud	129.004
	SRR3591713	Yellow flower	186.079
SRP173429	SRR8316895	Juvenile bud stage	92.811
	SRR8316896	Juvenile bud stage	158.159
	SRR8316897	Juvenile bud stage	76.398
	SRR8316894	Third green stage	56.387
	SRR8316900	Third green stage	192.142
	SRR8316901	Third green stage	188.391
	SRR8316898	Complete white stage	79.286
	SRR8316899	Complete white stage	242.648
	SRR8316903	Complete white stage	122.738
	SRR8316902	Silver flowering stage	74.216
	SRR8316904	Silver flowering stage	76.120
	SRR8316905	Silver flowering stage	42.564
	SRR8316906	Gold flowering stage	173.309
	SRR8316907	Gold flowering stage	167.979
	SRR8316908	Gold flowering stage	172.130
SRP132670	SRR6706286	Control	305.476
	SRR6706287	Light intensity 50%	259.523
	SRR6706288	Light intensity 20%	258.769
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	151.110
	CNS0095593	Slightly white alabastrum(diploid) 2	159.635
	CNS0095594	Slightly white alabastrum(diploid) 3	144.638
	CNS0095595	Whole white alabastrum(diploid) 2	147.361
	CNS0095596	Whole white alabastrum(diploid) 3	149.826
	CNS0095597	Whole white alabastrum(diploid) 4	136.342
	CNS0095598	Silvery flower (diploied) 1	120.324
	CNS0095599	Silvery flower (diploied) 2	133.590
	CNS0095600	Silvery flower (diploied) 3	149.624
	CNS0095601	Golden flower (diploid) 1	146.424
	CNS0095602	Golden flower (diploid) 2	174.043
	CNS0095603	Golden flower (diploid) 3	161.725
	CNS0095604	Slightly white alabastrum(tetraploid) 1	137.909
	CNS0095605	Slightly white alabastrum(tetraploid) 2	134.071
	CNS0095606	Slightly white alabastrum(tetraploid) 3	124.694
	CNS0095607	Whole white alabastrum(tetraploid) 1	134.567
	CNS0095608	Whole white alabastrum(tetraploid) 2	141.014
	CNS0095609	Whole white alabastrum(tetraploid) 3	148.038
	CNS0095610	Silvery flower (tetraploid) 1	185.297
	CNS0095611	Silvery flower (tetraploid) 2	247.566
	CNS0095612	Silvery flower (tetraploid) 3	218.219
	CNS0095613	Golden flower (tetraploid) 1	193.469
	CNS0095614	Golden flower (tetraploid) 2	230.274
	CNS0095615	Golden flower (tetraploid) 3	183.894
CRA001975	CRR073297	Stem 1	130.931
	CRR073298	Stem 2	116.967
	CRR073299	Stem 3	103.656
	CRR073300	Leaf 1	156.778
	CRR073301	Leaf 2	167.266
	CRR073302	Leaf 3	153.262
	CRR073303	Juvenile bud 1	173.662
	CRR073304	Juvenile bud 2	162.253
	CRR073305	Juvenile bud 3	206.405
	CRR073306	Third green 1	79.143
	CRR073307	Third green 2	100.505
	CRR073308	Third green 3	94.049
	CRR073309	Second white 1	135.042
	CRR073310	Second white 2	82.569
	CRR073311	Second white 3	72.256
	CRR073312	Silver flowering 1	88.113
	CRR073313	Silver flowering 2	100.640
	CRR073314	Silver flowering 3	62.809
	CRR073315	Gold flowering 1	55.746
	CRR073316	Gold flowering 2	56.895
	CRR073317	Gold flowering 3	58.669
	CRR073318	Tawny withering 1	142.172
	CRR073319	Tawny withering 2	120.621
	CRR073320	Tawny withering 3	95.058