Gene detail

Detail information of GWHGAAZE027334

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_003634760.1	1.02043E-71	PREDICTED: nuclear transcription factor Y subunit B-3 [Vitis vinifera]
Swissprot	tr\|O23310\|NFYB3_ARATH	2E-55	Nuclear transcription factor Y subunit B-3
trEMBL	tr\|D7UAG5\|D7UAG5_VITVI	4E-72	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI39730.3}
TAIR10	AT5G47640.1	2E-42	nuclear factor Y, subunit B2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	17874958	17875458	-
GWHAAZE00000008	mRNA	17874958	17875458	-
GWHAAZE00000008	exon	17874958	17875458	-
GWHAAZE00000008	CDS	17874958	17875458	-

Transcript Sequence
>GWHTAAZE027368 ATGAAGAAGGCCTTACCGGCGAACGCGAAGATCTCCAAGGATGCAAAGGAGACGGTGCAGGAGTGTGTGTCGGAGTTCATCAGCTTCGTCACCGGAGAAGCCTCCGACAAGTGTCAGAGAGAGAAGCGTAAGACTATCAACGGCGACGATTTGCTCTGGGCCATGACCACGCTAGGTTTTGAAGACTACGTCGAGCCTCTCAAGGTTTATCTCCAGAGGTTTAGGGATTTAGAGGGCGAGAGGACCGCCCTCGCCGGACGGCCAGGCGGAGAGGGGGAGAGCTCCGCCGGCGGAGTAGGCACTAATGGTAGCGTGGTAAATATGGGGAATAATGGTGGTGGTGGGATGTATAATAACATGATGATGATGATGGGGCATCCCCATCCGCAGGGACACGGGTATGGATCAGGTGGAGCTTACTATCAGATGCCTGGTAGTGGACCCGAAAAAATGGGGTCGGGTTATCCTGGGTCTGGGCCTTCTACTGGAAGACCAAGGTAG

Network for GWHGAAZE027334

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00808.24	CBFD_NFYB_HMF	1	55	1.40E-20

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NF-YB

KEGG pathway

KO	Enzyme	pathway	mapID
K08065	NFYB, HAP3	Antigen processing and presentation	map04612

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0005634	cellular_component	nucleus
GO:0043565	molecular_function	sequence-specific DNA binding
GO:0046982	molecular_function	protein heterodimerization activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	11.268
	SRR3591706	second leaf	21.070
	SRR3591707	mature leaf	22.368
	SRR3591708	Shoot apex	23.108
	SRR3591709	Stem	13.781
	SRR3591710	White floral bud	58.402
	SRR3591711	White flower	59.124
	SRR3591712	Green floral bud	5.570
	SRR3591713	Yellow flower	45.906
SRP173429	SRR8316895	Juvenile bud stage	4.980
	SRR8316896	Juvenile bud stage	11.953
	SRR8316897	Juvenile bud stage	2.538
	SRR8316894	Third green stage	2.333
	SRR8316900	Third green stage	10.633
	SRR8316901	Third green stage	7.978
	SRR8316898	Complete white stage	28.210
	SRR8316899	Complete white stage	10.303
	SRR8316903	Complete white stage	35.078
	SRR8316902	Silver flowering stage	27.398
	SRR8316904	Silver flowering stage	28.062
	SRR8316905	Silver flowering stage	18.485
	SRR8316906	Gold flowering stage	60.083
	SRR8316907	Gold flowering stage	44.874
	SRR8316908	Gold flowering stage	46.373
SRP132670	SRR6706286	Control	17.274
	SRR6706287	Light intensity 50%	13.436
	SRR6706288	Light intensity 20%	10.199
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	11.153
	CNS0095593	Slightly white alabastrum(diploid) 2	8.052
	CNS0095594	Slightly white alabastrum(diploid) 3	9.457
	CNS0095595	Whole white alabastrum(diploid) 2	7.511
	CNS0095596	Whole white alabastrum(diploid) 3	7.137
	CNS0095597	Whole white alabastrum(diploid) 4	3.622
	CNS0095598	Silvery flower (diploied) 1	16.505
	CNS0095599	Silvery flower (diploied) 2	18.701
	CNS0095600	Silvery flower (diploied) 3	54.326
	CNS0095601	Golden flower (diploid) 1	30.576
	CNS0095602	Golden flower (diploid) 2	36.560
	CNS0095603	Golden flower (diploid) 3	39.473
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.029
	CNS0095605	Slightly white alabastrum(tetraploid) 2	6.350
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.800
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.332
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.623
	CNS0095609	Whole white alabastrum(tetraploid) 3	6.570
	CNS0095610	Silvery flower (tetraploid) 1	70.396
	CNS0095611	Silvery flower (tetraploid) 2	66.785
	CNS0095612	Silvery flower (tetraploid) 3	29.289
	CNS0095613	Golden flower (tetraploid) 1	35.411
	CNS0095614	Golden flower (tetraploid) 2	58.679
	CNS0095615	Golden flower (tetraploid) 3	61.888
CRA001975	CRR073297	Stem 1	17.273
	CRR073298	Stem 2	13.245
	CRR073299	Stem 3	16.229
	CRR073300	Leaf 1	5.669
	CRR073301	Leaf 2	7.513
	CRR073302	Leaf 3	5.903
	CRR073303	Juvenile bud 1	7.155
	CRR073304	Juvenile bud 2	4.728
	CRR073305	Juvenile bud 3	7.975
	CRR073306	Third green 1	8.217
	CRR073307	Third green 2	4.897
	CRR073308	Third green 3	7.356
	CRR073309	Second white 1	2.640
	CRR073310	Second white 2	3.875
	CRR073311	Second white 3	1.770
	CRR073312	Silver flowering 1	0.695
	CRR073313	Silver flowering 2	0.087
	CRR073314	Silver flowering 3	0.085
	CRR073315	Gold flowering 1	12.483
	CRR073316	Gold flowering 2	18.657
	CRR073317	Gold flowering 3	12.861
	CRR073318	Tawny withering 1	8.749
	CRR073319	Tawny withering 2	9.415
	CRR073320	Tawny withering 3	6.250