Gene detail

Detail information of GWHGAAZE027224

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009772888.1	2.24561E-97	PREDICTED: psbQ-like protein 2, chloroplastic [Nicotiana sylvestris]
Swissprot	tr\|Q9SGH4\|PQL2_ARATH	1E-76	PsbQ-like protein 2, chloroplastic (Precursor)
trEMBL	tr\|A0A068UC11\|A0A068UC11_COFCA	6E-94	Coffea canephora DH200=94 genomic scaffold, scaffold_19 {ECO:0000313\|EMBL:CDP05807.1}
TAIR10	AT3G01440.1	5E-62	PsbQ-like 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	16529468	16530455	-
GWHAAZE00000008	mRNA	16529468	16530455	-
GWHAAZE00000008	exon	16529468	16529566	-
GWHAAZE00000008	exon	16529659	16529945	-
GWHAAZE00000008	exon	16530170	16530455	-
GWHAAZE00000008	CDS	16530170	16530455	-
GWHAAZE00000008	CDS	16529659	16529945	-
GWHAAZE00000008	CDS	16529468	16529566	-

Transcript Sequence
>GWHTAAZE027258 ATGACTCTCACTGCCAATCTCAATGGAGTTTTGGCATCCCTACCCAACATTACAAAGCTTAACTGTTTCGAAAATGCCCTGAAGAGATCAACAGCAGTAATTAGTTTCCATGACAAGAAAACAACAAAGGAAATCCAAGAAAACTCAGTTAAAGCTACAAGGAGGACAGCATTAGGCCTTGCCTCAATAGCACTAGTCCTTGCACATTCTTCAACTTATAACTCTCTTGCAGATGACAATGGGTACTGGCTCACCACCCCTATTCCTGTACCATCTGCCTACAACAAGATTGCGAATGACGAGTCGGGTACTCGTTCTTTCCTCAAGAAAGGGATCTATATAGCGAATATTGGTACAAAAGGAAGGATACGTAGGCTAAAGAAGTACGCGTTTGATCTCTTGGCAATGGGGGATTTGATAGGACAAGACATGTGGCATTATATAAGGATGTATCTTCGCCTTAAATCCACCTTCATGTACTTTGATTTTGACAATGTAATTTCGGCATCTTCAGTAAATGATAAGCAGCCTCTCACCGACCTCGCAAATAGATTGTTTGACAACGTCGAAAAGCTTGAAGATGCTGTGAAAAAGCATGATCTTCCTGTGACGCAGTCACTTTATCAAGACACTACGACAATTCTTCAAGAGGTCATGGAAAGGATGGCATAA

Network for GWHGAAZE027224

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF05757.12	PsbQ	44	223	5.40E-51

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08901	psbQ	Photosynthesis	map00195

Gene Ontology

GO term	Ontology	Name
GO:0015979	biological_process	photosynthesis
GO:0009523	cellular_component	photosystem II
GO:0009654	cellular_component	photosystem II oxygen evolving complex
GO:0019898	cellular_component	extrinsic component of membrane
GO:0005509	molecular_function	calcium ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	9.895
	SRR3591706	second leaf	111.916
	SRR3591707	mature leaf	76.652
	SRR3591708	Shoot apex	37.893
	SRR3591709	Stem	4.731
	SRR3591710	White floral bud	1.624
	SRR3591711	White flower	2.842
	SRR3591712	Green floral bud	0.704
	SRR3591713	Yellow flower	0.176
SRP173429	SRR8316895	Juvenile bud stage	9.126
	SRR8316896	Juvenile bud stage	4.825
	SRR8316897	Juvenile bud stage	4.338
	SRR8316894	Third green stage	1.844
	SRR8316900	Third green stage	2.099
	SRR8316901	Third green stage	0.911
	SRR8316898	Complete white stage	0.098
	SRR8316899	Complete white stage	0.484
	SRR8316903	Complete white stage	2.033
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.134
SRP132670	SRR6706286	Control	2.764
	SRR6706287	Light intensity 50%	1.185
	SRR6706288	Light intensity 20%	1.098
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.780
	CNS0095593	Slightly white alabastrum(diploid) 2	1.857
	CNS0095594	Slightly white alabastrum(diploid) 3	2.795
	CNS0095595	Whole white alabastrum(diploid) 2	0.582
	CNS0095596	Whole white alabastrum(diploid) 3	1.228
	CNS0095597	Whole white alabastrum(diploid) 4	0.109
	CNS0095598	Silvery flower (diploied) 1	17.425
	CNS0095599	Silvery flower (diploied) 2	13.932
	CNS0095600	Silvery flower (diploied) 3	2.152
	CNS0095601	Golden flower (diploid) 1	15.969
	CNS0095602	Golden flower (diploid) 2	5.640
	CNS0095603	Golden flower (diploid) 3	5.447
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.032
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.513
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.988
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.744
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.638
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.441
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	3.258
	CNS0095612	Silvery flower (tetraploid) 3	0.333
	CNS0095613	Golden flower (tetraploid) 1	0.152
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.346
CRA001975	CRR073297	Stem 1	15.224
	CRR073298	Stem 2	11.617
	CRR073299	Stem 3	15.384
	CRR073300	Leaf 1	1.247
	CRR073301	Leaf 2	0.873
	CRR073302	Leaf 3	1.400
	CRR073303	Juvenile bud 1	0.180
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.300
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.099
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.039
	CRR073315	Gold flowering 1	55.604
	CRR073316	Gold flowering 2	58.018
	CRR073317	Gold flowering 3	35.046
	CRR073318	Tawny withering 1	4.951
	CRR073319	Tawny withering 2	1.425
	CRR073320	Tawny withering 3	4.153