Gene detail

Detail information of GWHGAAZE027221

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009586861.1	1.10278E-87	PREDICTED: histone H2A.6 [Nicotiana tomentosiformis]
Swissprot	tr\|Q9C681\|H2A1_ARATH	4E-86	Probable histone H2A.1
trEMBL	tr\|A9PCS9\|A9PCS9_POPTR	6E-88	Histone H2A {ECO:0000256\|RuleBase:RU003556}
TAIR10	AT1G51060.1	3E-46	histone H2A 10

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	16511299	16511929	+
GWHAAZE00000008	mRNA	16511299	16511929	+
GWHAAZE00000008	exon	16511299	16511487	+
GWHAAZE00000008	exon	16511717	16511929	+
GWHAAZE00000008	CDS	16511299	16511487	+
GWHAAZE00000008	CDS	16511717	16511929	+

Transcript Sequence
>GWHTAAZE027255 ATGGCAGGACGAGGCAAAACCCTAGGATCTGGAGCCGCGAAGAAGGCTACCTCTCGGAGCAGCAAGGCTGGTCTTCAATTTCCGGTCGGCCGTATTGCACGTTTTTTGAAGGCCGGCAAGTACGCCGAGCGTGTCGGAGCCGGAGCTCCGGTCTACCTCGCCGCCGTCCTTGAATATCTTGCCGCTGAGGTGCTTGAATTGGCCGGAAATGCTGCGAGAGATAACAAGAAGACTCGAATTGTGCCCCGACACATTCAATTGGCGGTGAGGAACGATGAAGAGCTAAGCAAGCTTCTTGGTGATGTGACGATTGCTAATGGCGGCGTTATGCCAAACATTCACAATCTTCTTCTTCCGAAGAAGACCGGAGGTTCATCGAAGCCTTCTGCTGATGATGATTAA

Network for GWHGAAZE027221

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00125.25	Histone	13	90	2.10E-14
PF16211.6	Histone_H2A_C	93	127	3.40E-19

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K11251	H2A	Necroptosis	map04217

Gene Ontology

GO term	Ontology	Name
GO:0000786	cellular_component	nucleosome
GO:0005634	cellular_component	nucleus
GO:0003677	molecular_function	DNA binding
GO:0046982	molecular_function	protein heterodimerization activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	211.517
	SRR3591706	second leaf	179.479
	SRR3591707	mature leaf	257.965
	SRR3591708	Shoot apex	592.616
	SRR3591709	Stem	180.047
	SRR3591710	White floral bud	149.870
	SRR3591711	White flower	128.718
	SRR3591712	Green floral bud	159.739
	SRR3591713	Yellow flower	122.348
SRP173429	SRR8316895	Juvenile bud stage	117.297
	SRR8316896	Juvenile bud stage	152.424
	SRR8316897	Juvenile bud stage	62.258
	SRR8316894	Third green stage	53.794
	SRR8316900	Third green stage	166.517
	SRR8316901	Third green stage	171.037
	SRR8316898	Complete white stage	64.865
	SRR8316899	Complete white stage	197.938
	SRR8316903	Complete white stage	101.527
	SRR8316902	Silver flowering stage	51.253
	SRR8316904	Silver flowering stage	56.878
	SRR8316905	Silver flowering stage	31.938
	SRR8316906	Gold flowering stage	132.053
	SRR8316907	Gold flowering stage	116.312
	SRR8316908	Gold flowering stage	124.954
SRP132670	SRR6706286	Control	176.500
	SRR6706287	Light intensity 50%	152.563
	SRR6706288	Light intensity 20%	135.184
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	187.917
	CNS0095593	Slightly white alabastrum(diploid) 2	185.404
	CNS0095594	Slightly white alabastrum(diploid) 3	186.582
	CNS0095595	Whole white alabastrum(diploid) 2	146.829
	CNS0095596	Whole white alabastrum(diploid) 3	135.018
	CNS0095597	Whole white alabastrum(diploid) 4	124.271
	CNS0095598	Silvery flower (diploied) 1	157.980
	CNS0095599	Silvery flower (diploied) 2	144.847
	CNS0095600	Silvery flower (diploied) 3	120.794
	CNS0095601	Golden flower (diploid) 1	177.968
	CNS0095602	Golden flower (diploid) 2	153.807
	CNS0095603	Golden flower (diploid) 3	156.804
	CNS0095604	Slightly white alabastrum(tetraploid) 1	243.251
	CNS0095605	Slightly white alabastrum(tetraploid) 2	224.891
	CNS0095606	Slightly white alabastrum(tetraploid) 3	369.616
	CNS0095607	Whole white alabastrum(tetraploid) 1	155.003
	CNS0095608	Whole white alabastrum(tetraploid) 2	131.365
	CNS0095609	Whole white alabastrum(tetraploid) 3	171.541
	CNS0095610	Silvery flower (tetraploid) 1	108.892
	CNS0095611	Silvery flower (tetraploid) 2	117.369
	CNS0095612	Silvery flower (tetraploid) 3	94.792
	CNS0095613	Golden flower (tetraploid) 1	150.700
	CNS0095614	Golden flower (tetraploid) 2	138.847
	CNS0095615	Golden flower (tetraploid) 3	140.684
CRA001975	CRR073297	Stem 1	220.581
	CRR073298	Stem 2	189.337
	CRR073299	Stem 3	318.397
	CRR073300	Leaf 1	160.821
	CRR073301	Leaf 2	159.033
	CRR073302	Leaf 3	215.776
	CRR073303	Juvenile bud 1	171.280
	CRR073304	Juvenile bud 2	165.291
	CRR073305	Juvenile bud 3	156.088
	CRR073306	Third green 1	124.918
	CRR073307	Third green 2	130.980
	CRR073308	Third green 3	108.894
	CRR073309	Second white 1	116.949
	CRR073310	Second white 2	111.107
	CRR073311	Second white 3	93.967
	CRR073312	Silver flowering 1	148.258
	CRR073313	Silver flowering 2	199.006
	CRR073314	Silver flowering 3	151.394
	CRR073315	Gold flowering 1	284.637
	CRR073316	Gold flowering 2	270.899
	CRR073317	Gold flowering 3	286.510
	CRR073318	Tawny withering 1	287.734
	CRR073319	Tawny withering 2	296.535
	CRR073320	Tawny withering 3	325.192