Gene detail

Detail information of GWHGAAZE027201

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CBI20399.3	6.11283E-31	unnamed protein product [Vitis vinifera]
Swissprot	tr\|Q8L6Y1\|UBP14_ARATH	7E-27	Ubiquitin carboxyl-terminal hydrolase 14
trEMBL	tr\|F6H2F7\|F6H2F7_VITVI	2E-31	Ubiquitin carboxyl-terminal hydrolase {ECO:0000256\|RuleBase:RU004435}
TAIR10	AT3G20630.1	1E-23	ubiquitin-specific protease 14

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	16128365	16132500	+
GWHAAZE00000008	mRNA	16128365	16132500	+
GWHAAZE00000008	exon	16128365	16128436	+
GWHAAZE00000008	exon	16131038	16131140	+
GWHAAZE00000008	exon	16131478	16131568	+
GWHAAZE00000008	exon	16132290	16132500	+
GWHAAZE00000008	CDS	16128365	16128436	+
GWHAAZE00000008	CDS	16131038	16131140	+
GWHAAZE00000008	CDS	16131478	16131568	+
GWHAAZE00000008	CDS	16132290	16132500	+

Transcript Sequence
>GWHTAAZE027235 TATGATCTAGCTCTGCATATGCGAAAATTTGTTATGGCGCATGTAGGAAGGCTGGGTGCCGAAAAAGCTTTGATGGGATTTAACTATCCTCATCGTCAAAAGATTGCTATCAAAACATCAGATGCTGGAGTGGAAGAGGTCATGAACTGGTTATTTCTCCACATGGATGATCCAGGTACTGAGAAAGCTACAGATTGGATATTCAGTGGTGATGCTTCTGATTCATCTGATGTGGATGGCTGGATGCTACTAGTTGCTTACTGGTGGCTTCTAGGTCTAGTGAGCCACATGGGTACCTCTACGCAGTATGGCCGCTATGTTGCTCATATCTTCAAAAGTGGGAGGTGGATTATTTTCAATGACGAAAAGGTCGGAGCTTCAAAAGACCACCCAAAGGACATGGCAGGTCTACTTCTTCTAGAGAATCGACAGTTGATATACTTACGAAAGACGTACAAGGCTGAAAGACCTTGTTAG

Network for GWHGAAZE027201

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00443.30	UCH	65	130	7.60E-08

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	USP

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0016579	biological_process	protein deubiquitination
GO:0036459	molecular_function	thiol-dependent ubiquitinyl hydrolase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	29.488
	SRR3591706	second leaf	25.490
	SRR3591707	mature leaf	34.464
	SRR3591708	Shoot apex	39.661
	SRR3591709	Stem	14.379
	SRR3591710	White floral bud	0.479
	SRR3591711	White flower	0.437
	SRR3591712	Green floral bud	0.180
	SRR3591713	Yellow flower	0.172
SRP173429	SRR8316895	Juvenile bud stage	0.621
	SRR8316896	Juvenile bud stage	0.576
	SRR8316897	Juvenile bud stage	0.186
	SRR8316894	Third green stage	0.216
	SRR8316900	Third green stage	0.262
	SRR8316901	Third green stage	1.561
	SRR8316898	Complete white stage	1.754
	SRR8316899	Complete white stage	0.335
	SRR8316903	Complete white stage	1.795
	SRR8316902	Silver flowering stage	1.987
	SRR8316904	Silver flowering stage	1.452
	SRR8316905	Silver flowering stage	0.987
	SRR8316906	Gold flowering stage	1.125
	SRR8316907	Gold flowering stage	0.117
	SRR8316908	Gold flowering stage	0.343
SRP132670	SRR6706286	Control	0.747
	SRR6706287	Light intensity 50%	0.633
	SRR6706288	Light intensity 20%	0.614
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.641
	CNS0095593	Slightly white alabastrum(diploid) 2	0.455
	CNS0095594	Slightly white alabastrum(diploid) 3	0.104
	CNS0095595	Whole white alabastrum(diploid) 2	0.325
	CNS0095596	Whole white alabastrum(diploid) 3	0.410
	CNS0095597	Whole white alabastrum(diploid) 4	0.759
	CNS0095598	Silvery flower (diploied) 1	1.272
	CNS0095599	Silvery flower (diploied) 2	3.647
	CNS0095600	Silvery flower (diploied) 3	5.834
	CNS0095601	Golden flower (diploid) 1	0.868
	CNS0095602	Golden flower (diploid) 2	2.419
	CNS0095603	Golden flower (diploid) 3	2.214
	CNS0095604	Slightly white alabastrum(tetraploid) 1	14.783
	CNS0095605	Slightly white alabastrum(tetraploid) 2	11.338
	CNS0095606	Slightly white alabastrum(tetraploid) 3	22.766
	CNS0095607	Whole white alabastrum(tetraploid) 1	13.513
	CNS0095608	Whole white alabastrum(tetraploid) 2	8.758
	CNS0095609	Whole white alabastrum(tetraploid) 3	10.690
	CNS0095610	Silvery flower (tetraploid) 1	30.467
	CNS0095611	Silvery flower (tetraploid) 2	19.650
	CNS0095612	Silvery flower (tetraploid) 3	14.290
	CNS0095613	Golden flower (tetraploid) 1	18.909
	CNS0095614	Golden flower (tetraploid) 2	21.240
	CNS0095615	Golden flower (tetraploid) 3	8.004
CRA001975	CRR073297	Stem 1	0.270
	CRR073298	Stem 2	0.463
	CRR073299	Stem 3	0.106
	CRR073300	Leaf 1	0.081
	CRR073301	Leaf 2	0.623
	CRR073302	Leaf 3	0.231
	CRR073303	Juvenile bud 1	0.187
	CRR073304	Juvenile bud 2	1.502
	CRR073305	Juvenile bud 3	0.015
	CRR073306	Third green 1	0.069
	CRR073307	Third green 2	0.354
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.019
	CRR073310	Second white 2	0.011
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.217
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.012
	CRR073317	Gold flowering 3	0.033
	CRR073318	Tawny withering 1	0.054
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000