Gene detail

Detail information of GWHGAAZE027170

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010042338.1	1.05421E-64	PREDICTED: thioredoxin-like, partial [Eucalyptus grandis]
COG	YP_007080187.1	1E-47	thioredoxin
Swissprot	tr\|P48384\|TRXM_PEA	3E-53	Thioredoxin M-type, chloroplastic (Precursor)
trEMBL	tr\|A0A059BUW0\|A0A059BUW0_EUCGR	5E-65	Uncharacterized protein {ECO:0000313\|EMBL:KCW70013.1}
TAIR10	AT3G15360.1	3E-42	thioredoxin M-type 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	15657976	15658290	+
GWHAAZE00000008	mRNA	15657976	15658290	+
GWHAAZE00000008	exon	15657976	15658290	+
GWHAAZE00000008	CDS	15657976	15658290	+

Transcript Sequence
>GWHTAAZE027204 GCGCCTCCGGTGACTGATGCAACGTGGCAGTCGCTTGTCCTTGAGTCTGAATCCCCTGTTCTAGTTGAATTTTGGGCTCCATGGTGCGGGCCATGCCGCATGATCCAACCTGTAATTGATGAGCTGGCTAGGCAGTATGTTGGGAAGCTCAAGTGCTACAAGGTGAATACTGATGAAAGCCCTTCGATAGCAACCCGATACGGTATAAGAAGCATCCCGACTGTAATAATTTTCAAAAGCGGAGAGAAGAAAGATGCTATTATCGGTGCGGTTCCCAAATCGACACTTACCACAAGCATAGAAAAATTCTTGTAG

Network for GWHGAAZE027170

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00085.21	Thioredoxin	4	101	3.40E-31

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03671	trxA	NOD-like receptor signaling pathway	map04621

Gene Ontology

GO term	Ontology	Name
GO:0045454	biological_process	cell redox homeostasis
GO:0006662	biological_process	glycerol ether metabolic process
GO:0015035	molecular_function	protein disulfide oxidoreductase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	43.002
	SRR3591706	second leaf	55.262
	SRR3591707	mature leaf	102.572
	SRR3591708	Shoot apex	56.980
	SRR3591709	Stem	44.141
	SRR3591710	White floral bud	42.777
	SRR3591711	White flower	71.539
	SRR3591712	Green floral bud	58.821
	SRR3591713	Yellow flower	90.009
SRP173429	SRR8316895	Juvenile bud stage	32.731
	SRR8316896	Juvenile bud stage	31.786
	SRR8316897	Juvenile bud stage	22.166
	SRR8316894	Third green stage	11.058
	SRR8316900	Third green stage	46.206
	SRR8316901	Third green stage	47.234
	SRR8316898	Complete white stage	29.980
	SRR8316899	Complete white stage	79.489
	SRR8316903	Complete white stage	34.649
	SRR8316902	Silver flowering stage	30.353
	SRR8316904	Silver flowering stage	34.207
	SRR8316905	Silver flowering stage	25.146
	SRR8316906	Gold flowering stage	61.175
	SRR8316907	Gold flowering stage	58.902
	SRR8316908	Gold flowering stage	44.091
SRP132670	SRR6706286	Control	41.673
	SRR6706287	Light intensity 50%	35.935
	SRR6706288	Light intensity 20%	41.609
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	47.468
	CNS0095593	Slightly white alabastrum(diploid) 2	46.001
	CNS0095594	Slightly white alabastrum(diploid) 3	40.487
	CNS0095595	Whole white alabastrum(diploid) 2	38.754
	CNS0095596	Whole white alabastrum(diploid) 3	44.980
	CNS0095597	Whole white alabastrum(diploid) 4	50.425
	CNS0095598	Silvery flower (diploied) 1	76.562
	CNS0095599	Silvery flower (diploied) 2	75.642
	CNS0095600	Silvery flower (diploied) 3	88.537
	CNS0095601	Golden flower (diploid) 1	95.747
	CNS0095602	Golden flower (diploid) 2	79.293
	CNS0095603	Golden flower (diploid) 3	81.282
	CNS0095604	Slightly white alabastrum(tetraploid) 1	45.331
	CNS0095605	Slightly white alabastrum(tetraploid) 2	43.505
	CNS0095606	Slightly white alabastrum(tetraploid) 3	48.059
	CNS0095607	Whole white alabastrum(tetraploid) 1	36.586
	CNS0095608	Whole white alabastrum(tetraploid) 2	43.868
	CNS0095609	Whole white alabastrum(tetraploid) 3	48.098
	CNS0095610	Silvery flower (tetraploid) 1	80.564
	CNS0095611	Silvery flower (tetraploid) 2	119.268
	CNS0095612	Silvery flower (tetraploid) 3	57.805
	CNS0095613	Golden flower (tetraploid) 1	120.580
	CNS0095614	Golden flower (tetraploid) 2	98.827
	CNS0095615	Golden flower (tetraploid) 3	226.687
CRA001975	CRR073297	Stem 1	62.668
	CRR073298	Stem 2	56.043
	CRR073299	Stem 3	91.687
	CRR073300	Leaf 1	49.215
	CRR073301	Leaf 2	55.398
	CRR073302	Leaf 3	66.387
	CRR073303	Juvenile bud 1	69.150
	CRR073304	Juvenile bud 2	66.592
	CRR073305	Juvenile bud 3	56.390
	CRR073306	Third green 1	18.637
	CRR073307	Third green 2	23.599
	CRR073308	Third green 3	17.371
	CRR073309	Second white 1	39.470
	CRR073310	Second white 2	28.778
	CRR073311	Second white 3	17.033
	CRR073312	Silver flowering 1	19.256
	CRR073313	Silver flowering 2	19.494
	CRR073314	Silver flowering 3	19.535
	CRR073315	Gold flowering 1	224.410
	CRR073316	Gold flowering 2	212.265
	CRR073317	Gold flowering 3	212.502
	CRR073318	Tawny withering 1	52.996
	CRR073319	Tawny withering 2	25.554
	CRR073320	Tawny withering 3	51.581