Gene detail

Detail information of GWHGAAZE027148

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AIC33041.1	1.72252E-50	30S ribosomal protein S20, partial [Panax ginseng]
COG	YP_007118368.1	0.00000001	30S ribosomal protein S20
Swissprot	tr\|Q9ASV6\|RR20_ARATH	2E-34	30S ribosomal protein S20, chloroplastic (Precursor)
trEMBL	tr\|A0A060IGE4\|A0A060IGE4_PANGI	6E-51	30S ribosomal protein S20 {ECO:0000313\|EMBL:AIC33041.1} (Fragment)
TAIR10	AT3G15190.1	9E-26	chloroplast 30S ribosomal protein S20, putative

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	15403933	15405864	+
GWHAAZE00000008	mRNA	15403933	15405864	+
GWHAAZE00000008	exon	15403933	15404050	+
GWHAAZE00000008	exon	15404665	15404743	+
GWHAAZE00000008	exon	15404873	15404975	+
GWHAAZE00000008	exon	15405607	15405864	+
GWHAAZE00000008	CDS	15403933	15404050	+
GWHAAZE00000008	CDS	15404665	15404743	+
GWHAAZE00000008	CDS	15404873	15404975	+
GWHAAZE00000008	CDS	15405607	15405864	+

Transcript Sequence
>GWHTAAZE027182 TTCGTTTCGCTAAGCCCTATCCTCAAGAAGCCACTTCGCCACTCAATTGTGTGCGAAGCGGCTCCCACTAAGAAGGCCGATTCGGCGGTGAAAAGGGCTCGTCAGGCCGAGAAAAGGCAGTGGGTTGTATTGCAAAATTATGTTGTGTTATCATCCATTGGTGAAACTGTGAAAGCATCTCACAAAAAGAAGGATAGGGTTTCGGTTGTTGGATCCAATTCAGGGAAAGACAGTTCGAGTGGTTCTATCTCAAGGAGTTACATATTTTTGACGAATCTTTTTGCACATGATCTCAGCTCATATTTCTTTATCATTATACAGGTTTTGGTATCACTGGACGCTCTAAGAAAGAAAAAAGATGCGCAACCTGAGGAAGTTCTGACCATAGAGAAGCTGATAGCAGAGGCGTATTCGGTGATTGATAAAGCAGTGAAAGTAGGTACGTTGCACAGGAACACTGGAGCCAACAGGAAGTCACGTCTAGCAAGAAGAAAGAAAGCCATTGAAATCCACCATGGCTGGTACACTCCTACTACTCCCGACTCCGCACAAGTATAA

Network for GWHGAAZE027148

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01649.19	Ribosomal_S20p	125	164	2.30E-10

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02968	RP-S20, rpsT	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003723	molecular_function	RNA binding
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	75.600
	SRR3591706	second leaf	196.474
	SRR3591707	mature leaf	152.400
	SRR3591708	Shoot apex	171.574
	SRR3591709	Stem	43.228
	SRR3591710	White floral bud	35.785
	SRR3591711	White flower	50.583
	SRR3591712	Green floral bud	78.011
	SRR3591713	Yellow flower	56.145
SRP173429	SRR8316895	Juvenile bud stage	59.636
	SRR8316896	Juvenile bud stage	64.063
	SRR8316897	Juvenile bud stage	48.575
	SRR8316894	Third green stage	30.663
	SRR8316900	Third green stage	109.520
	SRR8316901	Third green stage	95.338
	SRR8316898	Complete white stage	28.831
	SRR8316899	Complete white stage	74.414
	SRR8316903	Complete white stage	30.816
	SRR8316902	Silver flowering stage	23.428
	SRR8316904	Silver flowering stage	24.615
	SRR8316905	Silver flowering stage	15.664
	SRR8316906	Gold flowering stage	49.778
	SRR8316907	Gold flowering stage	48.449
	SRR8316908	Gold flowering stage	47.942
SRP132670	SRR6706286	Control	79.700
	SRR6706287	Light intensity 50%	73.557
	SRR6706288	Light intensity 20%	87.668
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	90.317
	CNS0095593	Slightly white alabastrum(diploid) 2	70.957
	CNS0095594	Slightly white alabastrum(diploid) 3	66.614
	CNS0095595	Whole white alabastrum(diploid) 2	76.952
	CNS0095596	Whole white alabastrum(diploid) 3	89.710
	CNS0095597	Whole white alabastrum(diploid) 4	71.068
	CNS0095598	Silvery flower (diploied) 1	80.950
	CNS0095599	Silvery flower (diploied) 2	76.814
	CNS0095600	Silvery flower (diploied) 3	83.122
	CNS0095601	Golden flower (diploid) 1	80.327
	CNS0095602	Golden flower (diploid) 2	75.833
	CNS0095603	Golden flower (diploid) 3	74.105
	CNS0095604	Slightly white alabastrum(tetraploid) 1	76.456
	CNS0095605	Slightly white alabastrum(tetraploid) 2	89.608
	CNS0095606	Slightly white alabastrum(tetraploid) 3	79.829
	CNS0095607	Whole white alabastrum(tetraploid) 1	50.992
	CNS0095608	Whole white alabastrum(tetraploid) 2	67.862
	CNS0095609	Whole white alabastrum(tetraploid) 3	85.521
	CNS0095610	Silvery flower (tetraploid) 1	67.841
	CNS0095611	Silvery flower (tetraploid) 2	93.289
	CNS0095612	Silvery flower (tetraploid) 3	75.098
	CNS0095613	Golden flower (tetraploid) 1	75.911
	CNS0095614	Golden flower (tetraploid) 2	70.356
	CNS0095615	Golden flower (tetraploid) 3	69.321
CRA001975	CRR073297	Stem 1	122.080
	CRR073298	Stem 2	105.611
	CRR073299	Stem 3	151.367
	CRR073300	Leaf 1	87.980
	CRR073301	Leaf 2	103.134
	CRR073302	Leaf 3	124.791
	CRR073303	Juvenile bud 1	125.475
	CRR073304	Juvenile bud 2	125.488
	CRR073305	Juvenile bud 3	87.456
	CRR073306	Third green 1	45.347
	CRR073307	Third green 2	34.298
	CRR073308	Third green 3	38.801
	CRR073309	Second white 1	81.878
	CRR073310	Second white 2	58.211
	CRR073311	Second white 3	47.491
	CRR073312	Silver flowering 1	60.422
	CRR073313	Silver flowering 2	60.804
	CRR073314	Silver flowering 3	71.923
	CRR073315	Gold flowering 1	314.798
	CRR073316	Gold flowering 2	310.080
	CRR073317	Gold flowering 3	279.575
	CRR073318	Tawny withering 1	51.664
	CRR073319	Tawny withering 2	58.982
	CRR073320	Tawny withering 3	63.261