Gene detail

Detail information of GWHGAAZE027137

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EYU44974.1	7.02124E-50	hypothetical protein MIMGU_mgv1a013901mg [Erythranthe guttata]
Swissprot	tr\|Q9FN29\|ATB52_ARATH	1E-30	Homeobox-leucine zipper protein ATHB-52
trEMBL	tr\|A0A022RY58\|A0A022RY58_ERYGU	3E-50	Uncharacterized protein {ECO:0000313\|EMBL:EYU44974.1}
TAIR10	AT5G53980.1	8E-21	homeobox protein 52

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	15286430	15286924	+
GWHAAZE00000008	mRNA	15286430	15286924	+
GWHAAZE00000008	exon	15286430	15286924	+
GWHAAZE00000008	CDS	15286430	15286924	+

Transcript Sequence
>GWHTAAZE027171 ATGAATCACTTGAATTCCCCAAACCAAAAACACTTTTCATCAAAGAACAACAAAAAGAGACTAAGCCAAGACCAAGTGAAGCACCTAGAGTTAAGCTTCGACTCAAACAAACGGCTTGAACCGGAGCTCAAGCTCCGGCTCTCCCGTGAGCTAGGCATTCTACCAAGACAAATAGCCATTTGGTACCAAAATAAGCGAGCTCGGTGGAAGAACCAGAGCCTCGAGCTCGACTACAGCACGCTTCAAATACGGCTCGAGAACACATTAGCCGAGAAAAAGCAGCTCGAGAGAGAGGTGGAGCGGCTACAAGTGGAGCTGCGTAAGGTACAACAAGATCAAGCACAACAACCTCCGACTGTTTCTTCAATCTCTAGTACTTGCTGTGACGAAGGAGGGAGCTCAAGCTTGCAGGATGATGTTAACAATTGTTGGGTTAATGATCATGACTTATATGCTTACTATTTTATGGGGGCAAATGGGTCAAACTGTGCTTAA

Network for GWHGAAZE027137

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00046.30	Homeodomain	16	71	8.20E-13

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	HB-other

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0043565	molecular_function	sequence-specific DNA binding
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.530
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.336
	SRR3591708	Shoot apex	0.481
	SRR3591709	Stem	3.639
	SRR3591710	White floral bud	0.435
	SRR3591711	White flower	1.292
	SRR3591712	Green floral bud	0.219
	SRR3591713	Yellow flower	1.645
SRP173429	SRR8316895	Juvenile bud stage	0.168
	SRR8316896	Juvenile bud stage	0.494
	SRR8316897	Juvenile bud stage	0.217
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.124
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.334
	SRR8316902	Silver flowering stage	0.279
	SRR8316904	Silver flowering stage	0.122
	SRR8316905	Silver flowering stage	0.128
	SRR8316906	Gold flowering stage	0.145
	SRR8316907	Gold flowering stage	0.576
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.057
	SRR6706287	Light intensity 50%	0.101
	SRR6706288	Light intensity 20%	0.239
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	1.314
	CNS0095599	Silvery flower (diploied) 2	0.610
	CNS0095600	Silvery flower (diploied) 3	0.898
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.652
	CNS0095603	Golden flower (diploid) 3	1.271
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.321
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.657
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.600
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.524
	CNS0095611	Silvery flower (tetraploid) 2	0.503
	CNS0095612	Silvery flower (tetraploid) 3	0.219
	CNS0095613	Golden flower (tetraploid) 1	2.700
	CNS0095614	Golden flower (tetraploid) 2	2.703
	CNS0095615	Golden flower (tetraploid) 3	1.246
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.456
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.072
	CRR073310	Second white 2	0.562
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.216
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	4.552
	CRR073316	Gold flowering 2	2.984
	CRR073317	Gold flowering 3	0.886
	CRR073318	Tawny withering 1	0.220
	CRR073319	Tawny withering 2	0.089
	CRR073320	Tawny withering 3	0.173