Gene detail

Detail information of GWHGAAZE027117

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006377751.1	5.6145E-104	hypothetical protein POPTR_0011s11260g [Populus trichocarpa]
COG	YP_008797956.1	9E-20	ubiquitin-conjugating enzyme E2-like protein
Swissprot	tr\|Q94A97\|UBC35_ARATH	3E-105	Ubiquitin-conjugating enzyme E2 35
trEMBL	tr\|U5FWF2\|U5FWF2_POPTR	2E-104	Uncharacterized protein {ECO:0000313\|EMBL:ERP55548.1}
TAIR10	AT1G78870.2	1E-82	ubiquitin-conjugating enzyme 35

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	14966861	14970087	+
GWHAAZE00000008	mRNA	14966861	14970087	+
GWHAAZE00000008	exon	14966861	14966896	+
GWHAAZE00000008	exon	14967045	14967072	+
GWHAAZE00000008	exon	14967441	14967527	+
GWHAAZE00000008	exon	14968167	14968225	+
GWHAAZE00000008	exon	14969355	14969396	+
GWHAAZE00000008	exon	14969485	14969558	+
GWHAAZE00000008	exon	14969829	14969965	+
GWHAAZE00000008	exon	14970050	14970087	+
GWHAAZE00000008	CDS	14966861	14966896	+
GWHAAZE00000008	CDS	14967045	14967072	+
GWHAAZE00000008	CDS	14967441	14967527	+
GWHAAZE00000008	CDS	14968167	14968225	+
GWHAAZE00000008	CDS	14969355	14969396	+
GWHAAZE00000008	CDS	14969485	14969558	+
GWHAAZE00000008	CDS	14969829	14969965	+
GWHAAZE00000008	CDS	14970050	14970087	+

Transcript Sequence
>GWHTAAZE027151 ATGGCAAATAGTAATCTACCTCGAAGAATCATCAAGGAAACTCAGCGTCTCCTAAGTGAACCAGCCCCAGGAATAAGTGCCTCTCCATCGGAAGACAATATGCGATACTTCAATGTAATGATTCTTGGTCCAACACAGTCTCCCTATGAAGGAGGGGTTTTCAAGCTGGAATTGTTTTTGCCTGAAGAATACCCGATGGCTGCTCCCAAGGTTCGGTTCCTCACCAAAATATACCATCCAAATATCGATAAGCTTGGAAGAATATGCCTTGATATTCTCAAAGACAAATGGAGCCCTGCCCTTCAGATTCGAACTGTACTACTCAGTATTCAGGCACTTTTGAGTGCTCCTAACCCTGACGATCCACTTTCTGAGAACATTGCAAAACATTGGAAAACAAACGAGGCCGAAGCTGTTGAAACAGGCATGTTAATATCATATTTTTGGGGGTTTGTCCTTGTATCAAAGGAGTGGACGCGTTTATATGCCAGTGGGGCATGA

Network for GWHGAAZE027117

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00179.27	UQ_con	9	137	5.30E-48

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	UBC

KEGG pathway

KO	Enzyme	pathway	mapID
K10580	UBE2N, BLU, UBC13	Ubiquitin mediated proteolysis	map04120
K10580	UBE2N, BLU, UBC13	Toll and Imd signaling pathway	map04624

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	136.366
	SRR3591706	second leaf	76.018
	SRR3591707	mature leaf	81.581
	SRR3591708	Shoot apex	90.598
	SRR3591709	Stem	162.287
	SRR3591710	White floral bud	115.588
	SRR3591711	White flower	152.637
	SRR3591712	Green floral bud	156.923
	SRR3591713	Yellow flower	150.068
SRP173429	SRR8316895	Juvenile bud stage	35.941
	SRR8316896	Juvenile bud stage	47.975
	SRR8316897	Juvenile bud stage	56.692
	SRR8316894	Third green stage	24.738
	SRR8316900	Third green stage	77.524
	SRR8316901	Third green stage	70.781
	SRR8316898	Complete white stage	29.768
	SRR8316899	Complete white stage	76.537
	SRR8316903	Complete white stage	54.703
	SRR8316902	Silver flowering stage	32.352
	SRR8316904	Silver flowering stage	36.661
	SRR8316905	Silver flowering stage	20.217
	SRR8316906	Gold flowering stage	73.132
	SRR8316907	Gold flowering stage	75.270
	SRR8316908	Gold flowering stage	112.703
SRP132670	SRR6706286	Control	104.366
	SRR6706287	Light intensity 50%	113.086
	SRR6706288	Light intensity 20%	113.416
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	50.084
	CNS0095593	Slightly white alabastrum(diploid) 2	52.756
	CNS0095594	Slightly white alabastrum(diploid) 3	45.125
	CNS0095595	Whole white alabastrum(diploid) 2	45.684
	CNS0095596	Whole white alabastrum(diploid) 3	44.104
	CNS0095597	Whole white alabastrum(diploid) 4	41.066
	CNS0095598	Silvery flower (diploied) 1	48.415
	CNS0095599	Silvery flower (diploied) 2	47.457
	CNS0095600	Silvery flower (diploied) 3	87.553
	CNS0095601	Golden flower (diploid) 1	47.980
	CNS0095602	Golden flower (diploid) 2	76.224
	CNS0095603	Golden flower (diploid) 3	74.959
	CNS0095604	Slightly white alabastrum(tetraploid) 1	102.093
	CNS0095605	Slightly white alabastrum(tetraploid) 2	88.005
	CNS0095606	Slightly white alabastrum(tetraploid) 3	122.007
	CNS0095607	Whole white alabastrum(tetraploid) 1	76.887
	CNS0095608	Whole white alabastrum(tetraploid) 2	72.065
	CNS0095609	Whole white alabastrum(tetraploid) 3	109.639
	CNS0095610	Silvery flower (tetraploid) 1	155.751
	CNS0095611	Silvery flower (tetraploid) 2	176.479
	CNS0095612	Silvery flower (tetraploid) 3	128.875
	CNS0095613	Golden flower (tetraploid) 1	135.083
	CNS0095614	Golden flower (tetraploid) 2	139.442
	CNS0095615	Golden flower (tetraploid) 3	167.623
CRA001975	CRR073297	Stem 1	55.048
	CRR073298	Stem 2	47.991
	CRR073299	Stem 3	56.992
	CRR073300	Leaf 1	52.413
	CRR073301	Leaf 2	55.296
	CRR073302	Leaf 3	57.860
	CRR073303	Juvenile bud 1	87.101
	CRR073304	Juvenile bud 2	67.587
	CRR073305	Juvenile bud 3	64.410
	CRR073306	Third green 1	34.803
	CRR073307	Third green 2	43.233
	CRR073308	Third green 3	37.440
	CRR073309	Second white 1	56.347
	CRR073310	Second white 2	38.788
	CRR073311	Second white 3	34.153
	CRR073312	Silver flowering 1	32.432
	CRR073313	Silver flowering 2	30.060
	CRR073314	Silver flowering 3	30.595
	CRR073315	Gold flowering 1	43.715
	CRR073316	Gold flowering 2	46.485
	CRR073317	Gold flowering 3	41.068
	CRR073318	Tawny withering 1	55.788
	CRR073319	Tawny withering 2	78.436
	CRR073320	Tawny withering 3	50.498