Gene detail

Detail information of GWHGAAZE027077

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AGX93056.1	4.77556E-25	7-deoxyloganic acid 7-hydroxylase-like protein [Lonicera japonica]
Swissprot	tr\|H2DH21\|C7A29_PANGI	2E-17	Cytochrome P450 CYP72A219
trEMBL	tr\|U5NH84\|U5NH84_LONJA	2E-25	7-deoxyloganic acid 7-hydroxylase-like protein {ECO:0000313\|EMBL:AGX93056.1}
TAIR10	AT3G14690.1	2E-13	cytochrome P450, family 72, subfamily A, polypeptide 15

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	14421888	14426703	+
GWHAAZE00000008	mRNA	14421888	14426703	+
GWHAAZE00000008	exon	14421888	14422154	+
GWHAAZE00000008	exon	14426578	14426703	+
GWHAAZE00000008	CDS	14421888	14422154	+
GWHAAZE00000008	CDS	14426578	14426703	+

Transcript Sequence
>GWHTAAZE027111 ATGAAGGCAATCGAGGCAGGAGAGAGTAATAGTAATGGTAGTACCAGTGATTTCTTGAGTATATTACTGGAATGCAATTTGATTAAGATTTTAGAACATGATAAAAATGAGAGTGGTGGAATGAGCATTGAAGACATAATTGGTGAGTGCAAACTATTCTACTTAGCTGGGCAAGACAGCACATCTACTTTGCTCTCGTCTGACAATGTTCTACATGTCTTTGGGAGTAGCAAACCCGACTATGATGGCATAAATTGCCTCAAAAATACTGGTAAATTGGGTATGGCTGAGACCAAAGAGACTGGAGAAATGCCTGAGAGAGCAAGGTTTCAGCGGAAACCCTTACAGACTCCTAAAGGGAGACCAGGAAGAGAGCTCTACGTTGATAGTTGA

Network for GWHGAAZE027077

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0005506	molecular_function	iron ion binding
GO:0016705	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	5.205
	SRR3591706	second leaf	12.391
	SRR3591707	mature leaf	20.070
	SRR3591708	Shoot apex	7.016
	SRR3591709	Stem	4.892
	SRR3591710	White floral bud	10.095
	SRR3591711	White flower	15.624
	SRR3591712	Green floral bud	11.643
	SRR3591713	Yellow flower	7.389
SRP173429	SRR8316895	Juvenile bud stage	2.037
	SRR8316896	Juvenile bud stage	2.923
	SRR8316897	Juvenile bud stage	2.697
	SRR8316894	Third green stage	1.147
	SRR8316900	Third green stage	4.840
	SRR8316901	Third green stage	5.620
	SRR8316898	Complete white stage	4.172
	SRR8316899	Complete white stage	10.564
	SRR8316903	Complete white stage	5.856
	SRR8316902	Silver flowering stage	4.646
	SRR8316904	Silver flowering stage	8.637
	SRR8316905	Silver flowering stage	4.063
	SRR8316906	Gold flowering stage	13.982
	SRR8316907	Gold flowering stage	11.613
	SRR8316908	Gold flowering stage	25.253
SRP132670	SRR6706286	Control	5.702
	SRR6706287	Light intensity 50%	7.266
	SRR6706288	Light intensity 20%	7.309
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.835
	CNS0095593	Slightly white alabastrum(diploid) 2	0.731
	CNS0095594	Slightly white alabastrum(diploid) 3	2.166
	CNS0095595	Whole white alabastrum(diploid) 2	2.613
	CNS0095596	Whole white alabastrum(diploid) 3	2.782
	CNS0095597	Whole white alabastrum(diploid) 4	2.395
	CNS0095598	Silvery flower (diploied) 1	9.390
	CNS0095599	Silvery flower (diploied) 2	5.284
	CNS0095600	Silvery flower (diploied) 3	20.624
	CNS0095601	Golden flower (diploid) 1	6.676
	CNS0095602	Golden flower (diploid) 2	17.895
	CNS0095603	Golden flower (diploid) 3	18.819
	CNS0095604	Slightly white alabastrum(tetraploid) 1	6.119
	CNS0095605	Slightly white alabastrum(tetraploid) 2	5.186
	CNS0095606	Slightly white alabastrum(tetraploid) 3	18.603
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.928
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.660
	CNS0095609	Whole white alabastrum(tetraploid) 3	22.298
	CNS0095610	Silvery flower (tetraploid) 1	80.069
	CNS0095611	Silvery flower (tetraploid) 2	40.773
	CNS0095612	Silvery flower (tetraploid) 3	37.995
	CNS0095613	Golden flower (tetraploid) 1	45.136
	CNS0095614	Golden flower (tetraploid) 2	86.463
	CNS0095615	Golden flower (tetraploid) 3	6.923
CRA001975	CRR073297	Stem 1	3.827
	CRR073298	Stem 2	3.646
	CRR073299	Stem 3	4.093
	CRR073300	Leaf 1	5.788
	CRR073301	Leaf 2	4.993
	CRR073302	Leaf 3	4.638
	CRR073303	Juvenile bud 1	3.420
	CRR073304	Juvenile bud 2	7.398
	CRR073305	Juvenile bud 3	4.633
	CRR073306	Third green 1	0.624
	CRR073307	Third green 2	1.288
	CRR073308	Third green 3	1.409
	CRR073309	Second white 1	1.925
	CRR073310	Second white 2	1.209
	CRR073311	Second white 3	0.942
	CRR073312	Silver flowering 1	0.882
	CRR073313	Silver flowering 2	0.558
	CRR073314	Silver flowering 3	0.593
	CRR073315	Gold flowering 1	4.050
	CRR073316	Gold flowering 2	3.594
	CRR073317	Gold flowering 3	2.117
	CRR073318	Tawny withering 1	4.924
	CRR073319	Tawny withering 2	0.512
	CRR073320	Tawny withering 3	1.860