Gene detail

Detail information of GWHGAAZE026976

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004513889.1	2.51963E-48	PREDICTED: ethylene-responsive transcription factor 7-like [Cicer arietinum]
Swissprot	tr\|O80339\|ERF82_ARATH	4E-39	Ethylene-responsive transcription factor 3
trEMBL	tr\|A0A072UXV4\|A0A072UXV4_MEDTR	2E-48	Ethylene response factor {ECO:0000313\|EMBL:KEH33908.1}
TAIR10	AT1G50640.1	4E-20	ethylene responsive element binding factor 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	13051872	13052513	+
GWHAAZE00000008	mRNA	13051872	13052513	+
GWHAAZE00000008	exon	13051872	13052166	+
GWHAAZE00000008	exon	13052215	13052513	+
GWHAAZE00000008	CDS	13051872	13052166	+
GWHAAZE00000008	CDS	13052215	13052513	+

Transcript Sequence
>GWHTAAZE027010 ATGCGACGAGGCGGCAGAACAAAACCAGCAGCATCATCAGCGGAAAAAGCAATCAGATCACTGCATAATCTCGAAAACGAGCCCCGATACCGCGGGGTGCGGAAGCGGCCGTGGGGCAGATTCGCCGCGGAGATCCGGGACCCCTGGAAGAAATCCCGGGTCTGGCTCGGCACTTTCGACACGGCCGTAGACGCCGCCCGGGCCTACGATGCTGCGGCTAGGTCCCTAAGGGGACCCAAGGCGAAGACCAATTTTCCCTTAATCATTGACCCCCACGATGATATTCATATTCCTTATTTTCAACAATTTTATCGTTCCCGCCCGAGTACCAGTAGCTTGAGTAGCACCGTCGAATCGTCTAGTGGTCCCCGTACGTATAATCCTTTGCTGCAGAGGATAAGGACCCACCACCGGTTGAAACCGCCGTTGCCTGCGCTACCGCCGGACGATTGCCATAGTGACTGTGACTCATCGTCGTCGGTGGTCGACAATTGCCGGAAACCCTTGCCGTTCGATCTGAACTTACCGGCGCCGTTGGACGATTTCGATATTGCTGGCGCTGATGATTTACACGCGACTACCCTTTGCCTCTAA

Network for GWHGAAZE026976

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	28	78	5.90E-14

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	16.657
	SRR3591706	second leaf	6.601
	SRR3591707	mature leaf	7.020
	SRR3591708	Shoot apex	16.121
	SRR3591709	Stem	21.284
	SRR3591710	White floral bud	32.152
	SRR3591711	White flower	29.545
	SRR3591712	Green floral bud	19.385
	SRR3591713	Yellow flower	44.525
SRP173429	SRR8316895	Juvenile bud stage	4.301
	SRR8316896	Juvenile bud stage	8.861
	SRR8316897	Juvenile bud stage	3.243
	SRR8316894	Third green stage	3.203
	SRR8316900	Third green stage	15.649
	SRR8316901	Third green stage	15.080
	SRR8316898	Complete white stage	11.714
	SRR8316899	Complete white stage	16.786
	SRR8316903	Complete white stage	18.386
	SRR8316902	Silver flowering stage	16.467
	SRR8316904	Silver flowering stage	16.337
	SRR8316905	Silver flowering stage	10.226
	SRR8316906	Gold flowering stage	35.049
	SRR8316907	Gold flowering stage	30.627
	SRR8316908	Gold flowering stage	37.495
SRP132670	SRR6706286	Control	19.626
	SRR6706287	Light intensity 50%	19.670
	SRR6706288	Light intensity 20%	16.327
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	21.372
	CNS0095593	Slightly white alabastrum(diploid) 2	17.841
	CNS0095594	Slightly white alabastrum(diploid) 3	19.044
	CNS0095595	Whole white alabastrum(diploid) 2	21.298
	CNS0095596	Whole white alabastrum(diploid) 3	23.418
	CNS0095597	Whole white alabastrum(diploid) 4	27.252
	CNS0095598	Silvery flower (diploied) 1	20.935
	CNS0095599	Silvery flower (diploied) 2	23.322
	CNS0095600	Silvery flower (diploied) 3	41.096
	CNS0095601	Golden flower (diploid) 1	24.593
	CNS0095602	Golden flower (diploid) 2	46.430
	CNS0095603	Golden flower (diploid) 3	42.836
	CNS0095604	Slightly white alabastrum(tetraploid) 1	14.998
	CNS0095605	Slightly white alabastrum(tetraploid) 2	16.638
	CNS0095606	Slightly white alabastrum(tetraploid) 3	12.479
	CNS0095607	Whole white alabastrum(tetraploid) 1	27.001
	CNS0095608	Whole white alabastrum(tetraploid) 2	33.856
	CNS0095609	Whole white alabastrum(tetraploid) 3	17.001
	CNS0095610	Silvery flower (tetraploid) 1	22.641
	CNS0095611	Silvery flower (tetraploid) 2	31.980
	CNS0095612	Silvery flower (tetraploid) 3	59.494
	CNS0095613	Golden flower (tetraploid) 1	34.182
	CNS0095614	Golden flower (tetraploid) 2	27.653
	CNS0095615	Golden flower (tetraploid) 3	60.374
CRA001975	CRR073297	Stem 1	17.995
	CRR073298	Stem 2	22.503
	CRR073299	Stem 3	22.381
	CRR073300	Leaf 1	28.017
	CRR073301	Leaf 2	28.777
	CRR073302	Leaf 3	22.271
	CRR073303	Juvenile bud 1	32.971
	CRR073304	Juvenile bud 2	24.102
	CRR073305	Juvenile bud 3	25.521
	CRR073306	Third green 1	45.048
	CRR073307	Third green 2	40.105
	CRR073308	Third green 3	37.362
	CRR073309	Second white 1	30.487
	CRR073310	Second white 2	38.625
	CRR073311	Second white 3	39.276
	CRR073312	Silver flowering 1	42.557
	CRR073313	Silver flowering 2	39.471
	CRR073314	Silver flowering 3	45.158
	CRR073315	Gold flowering 1	21.324
	CRR073316	Gold flowering 2	17.105
	CRR073317	Gold flowering 3	15.389
	CRR073318	Tawny withering 1	26.189
	CRR073319	Tawny withering 2	20.089
	CRR073320	Tawny withering 3	21.428