Gene detail

Detail information of GWHGAAZE026942

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KHG21050.1	5.112E-132	50S ribosomal L6, chloroplastic -like protein [Gossypium arboreum]
COG	YP_007142682.1	2E-64	50S ribosomal protein L6
Swissprot	tr\|O23049\|RK6_ARATH	6E-124	50S ribosomal protein L6, chloroplastic (Precursor)
trEMBL	tr\|D7TEL8\|D7TEL8_VITVI	6E-131	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI28941.3}
TAIR10	AT1G05190.1	3E-98	Ribosomal protein L6 family

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	12511981	12513515	+
GWHAAZE00000008	mRNA	12511981	12513515	+
GWHAAZE00000008	exon	12511981	12512315	+
GWHAAZE00000008	exon	12513179	12513515	+
GWHAAZE00000008	CDS	12511981	12512315	+
GWHAAZE00000008	CDS	12513179	12513515	+

Transcript Sequence
>GWHTAAZE026976 GGTGATAAATCTTTTCCATCACTCAGCAACTTGAGATCTGGTTTCTTTGGGGAGAGCAATGGACTCTATGTTTCCAGTGTTCCAGTCTCGCGTGTTGGATTTACAAGGAAGACTATAGAATGTAAAGAATCTAGAGTTGGGAAACAACCAATTGAAGTGCCATCTAATGTGAAAATCGCATTAGAAGGCCAAGATTTGAAAGTGAAGGGTCCATTAGGGGAACTTGCACTGACTTATCCACGAGAAGTAAAGGTCGATAGGGAGGAATCGGGGTTGCTTAGGGTTAGAAAGGCAACGGAGACAAGAAGGGCCAACCAAATGCATGGTCTATTCAGGACTTTGACCAGCAACATGGTGGTGGGCGTATCAAAGGGATTTGAGAAAAGACTTCAACTGATCGGTGTAGGGTACCGTGCAACTGTAGAAGGGAAAGTATTAGTATTGATTCTCGGATTTTCACACCCCGTTAGAATGGAAATCCCCGATGACCTGCAGGTGAAGGTAGAAGAAAATACTAGAATCGTTGTGAGCGGATACGACAAGGCTTCAATCGGTCAATTCGCCGCTTCGATTAGAAAGTGGAGACCACCAGAGCCCTACAAAGGTAAGGGTGTGAAATATGCTGATGAAATTGTAAGAAGAAAGGAGGGCAAAGCTGGGAAGAAGAAGTAA

Network for GWHGAAZE026942

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00347.24	Ribosomal_L6	53	125	6.40E-15
PF00347.24	Ribosomal_L6	133	207	6.20E-21

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02933	RP-L6, MRPL6, rplF	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome
GO:0019843	molecular_function	rRNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	112.989
	SRR3591706	second leaf	246.514
	SRR3591707	mature leaf	118.782
	SRR3591708	Shoot apex	235.198
	SRR3591709	Stem	37.093
	SRR3591710	White floral bud	47.943
	SRR3591711	White flower	30.658
	SRR3591712	Green floral bud	66.745
	SRR3591713	Yellow flower	40.551
SRP173429	SRR8316895	Juvenile bud stage	77.690
	SRR8316896	Juvenile bud stage	74.880
	SRR8316897	Juvenile bud stage	60.036
	SRR8316894	Third green stage	41.558
	SRR8316900	Third green stage	151.505
	SRR8316901	Third green stage	112.175
	SRR8316898	Complete white stage	44.863
	SRR8316899	Complete white stage	104.066
	SRR8316903	Complete white stage	56.438
	SRR8316902	Silver flowering stage	30.252
	SRR8316904	Silver flowering stage	40.745
	SRR8316905	Silver flowering stage	25.183
	SRR8316906	Gold flowering stage	63.746
	SRR8316907	Gold flowering stage	68.123
	SRR8316908	Gold flowering stage	77.671
SRP132670	SRR6706286	Control	115.978
	SRR6706287	Light intensity 50%	118.962
	SRR6706288	Light intensity 20%	135.037
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	64.569
	CNS0095593	Slightly white alabastrum(diploid) 2	63.007
	CNS0095594	Slightly white alabastrum(diploid) 3	49.500
	CNS0095595	Whole white alabastrum(diploid) 2	63.600
	CNS0095596	Whole white alabastrum(diploid) 3	68.866
	CNS0095597	Whole white alabastrum(diploid) 4	48.589
	CNS0095598	Silvery flower (diploied) 1	90.563
	CNS0095599	Silvery flower (diploied) 2	75.775
	CNS0095600	Silvery flower (diploied) 3	69.457
	CNS0095601	Golden flower (diploid) 1	71.512
	CNS0095602	Golden flower (diploid) 2	60.255
	CNS0095603	Golden flower (diploid) 3	61.487
	CNS0095604	Slightly white alabastrum(tetraploid) 1	70.659
	CNS0095605	Slightly white alabastrum(tetraploid) 2	65.044
	CNS0095606	Slightly white alabastrum(tetraploid) 3	101.341
	CNS0095607	Whole white alabastrum(tetraploid) 1	29.480
	CNS0095608	Whole white alabastrum(tetraploid) 2	48.824
	CNS0095609	Whole white alabastrum(tetraploid) 3	102.155
	CNS0095610	Silvery flower (tetraploid) 1	66.301
	CNS0095611	Silvery flower (tetraploid) 2	85.704
	CNS0095612	Silvery flower (tetraploid) 3	68.214
	CNS0095613	Golden flower (tetraploid) 1	46.848
	CNS0095614	Golden flower (tetraploid) 2	62.841
	CNS0095615	Golden flower (tetraploid) 3	51.552
CRA001975	CRR073297	Stem 1	141.647
	CRR073298	Stem 2	125.220
	CRR073299	Stem 3	154.528
	CRR073300	Leaf 1	93.425
	CRR073301	Leaf 2	92.934
	CRR073302	Leaf 3	134.924
	CRR073303	Juvenile bud 1	109.291
	CRR073304	Juvenile bud 2	120.816
	CRR073305	Juvenile bud 3	75.546
	CRR073306	Third green 1	58.710
	CRR073307	Third green 2	47.436
	CRR073308	Third green 3	39.585
	CRR073309	Second white 1	62.956
	CRR073310	Second white 2	53.521
	CRR073311	Second white 3	32.198
	CRR073312	Silver flowering 1	37.757
	CRR073313	Silver flowering 2	29.673
	CRR073314	Silver flowering 3	36.212
	CRR073315	Gold flowering 1	255.387
	CRR073316	Gold flowering 2	264.611
	CRR073317	Gold flowering 3	207.164
	CRR073318	Tawny withering 1	60.776
	CRR073319	Tawny withering 2	64.133
	CRR073320	Tawny withering 3	48.684