Gene detail

Detail information of GWHGAAZE026896

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP14712.1	3.02138E-88	unnamed protein product [Coffea canephora]
Swissprot	tr\|O64791\|SY124_ARATH	4E-80	Syntaxin-124
trEMBL	tr\|A0A068V2F3\|A0A068V2F3_COFCA	1E-88	Coffea canephora DH200=94 genomic scaffold, scaffold_91 {ECO:0000313\|EMBL:CDP14712.1}
TAIR10	AT1G61290.1	2E-60	syntaxin of plants 124

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	11644739	11645242	-
GWHAAZE00000008	mRNA	11644739	11645242	-
GWHAAZE00000008	exon	11645071	11645242	-
GWHAAZE00000008	exon	11644739	11645040	-
GWHAAZE00000008	CDS	11645071	11645242	-
GWHAAZE00000008	CDS	11644739	11645040	-

Transcript Sequence
>GWHTAAZE026930 ATGATGGATGATTTCCAAGGACTTAGACACAGAATGAATGAAGAGTATAAAGAGACGGTAGAACGACGATACTTTACCATCACGGGCGAAAAGGCTAACGAAGAGCTGATTGAAAACCTAATATCCAGCGGTGAAAGCGAGAACTTTTTGCAGAAGGCGATACAAGAGCAAGAGATACAAGAGAGGCACGATGCGGTGAAGGAGATAGAGAAAAATCTGGTGGAGCTGCACCAGATATTTTTGGACATGGCAGCGTTGGTGGAGGCACAGGGGCAGCAGTTGAATGATATAGAGAGTCACGTGGCGCATGCGAGTTCGTTCGTGAGGAGAGGGACAGAGCAATTGCAGGAGGCAAGGGAGTACCAGAAGAGCTCAAGGAAGTGCGGGTGTCTTGCTGTGATGCTGGTGATTGTGCTCATATTGGTTGTGCTTTATCCCATTTGGTCTACTATGTTGGTTCATGCGGTTATGTAG

Network for GWHGAAZE026896

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00804.26	Syntaxin	1	91	4.40E-33
PF05739.20	SNARE	93	144	1.20E-16

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08486	STX1B_2_3	SNARE interactions in vesicular transport	map04130
K08486	STX1B_2_3	Synaptic vesicle cycle	map04721

Gene Ontology

GO term	Ontology	Name
GO:0016192	biological_process	vesicle-mediated transport
GO:0006886	biological_process	intracellular protein transport
GO:0016020	cellular_component	membrane
GO:0005484	molecular_function	SNAP receptor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.197
	SRR3591709	Stem	1.337
	SRR3591710	White floral bud	211.131
	SRR3591711	White flower	7.741
	SRR3591712	Green floral bud	49.800
	SRR3591713	Yellow flower	6.471
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	5.708
	SRR8316901	Third green stage	1.537
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.375
	SRR8316903	Complete white stage	0.207
	SRR8316902	Silver flowering stage	1.678
	SRR8316904	Silver flowering stage	1.394
	SRR8316905	Silver flowering stage	1.069
	SRR8316906	Gold flowering stage	0.041
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	13.768
	SRR6706287	Light intensity 50%	18.796
	SRR6706288	Light intensity 20%	12.074
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.462
	CNS0095593	Slightly white alabastrum(diploid) 2	0.033
	CNS0095594	Slightly white alabastrum(diploid) 3	0.740
	CNS0095595	Whole white alabastrum(diploid) 2	15.263
	CNS0095596	Whole white alabastrum(diploid) 3	16.081
	CNS0095597	Whole white alabastrum(diploid) 4	58.715
	CNS0095598	Silvery flower (diploied) 1	6.580
	CNS0095599	Silvery flower (diploied) 2	31.351
	CNS0095600	Silvery flower (diploied) 3	3.134
	CNS0095601	Golden flower (diploid) 1	7.441
	CNS0095602	Golden flower (diploid) 2	3.122
	CNS0095603	Golden flower (diploid) 3	4.150
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.198
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.107
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.391
	CNS0095607	Whole white alabastrum(tetraploid) 1	36.418
	CNS0095608	Whole white alabastrum(tetraploid) 2	98.456
	CNS0095609	Whole white alabastrum(tetraploid) 3	19.175
	CNS0095610	Silvery flower (tetraploid) 1	3.575
	CNS0095611	Silvery flower (tetraploid) 2	9.364
	CNS0095612	Silvery flower (tetraploid) 3	26.201
	CNS0095613	Golden flower (tetraploid) 1	7.565
	CNS0095614	Golden flower (tetraploid) 2	0.953
	CNS0095615	Golden flower (tetraploid) 3	11.262
CRA001975	CRR073297	Stem 1	1.279
	CRR073298	Stem 2	1.557
	CRR073299	Stem 3	0.575
	CRR073300	Leaf 1	14.205
	CRR073301	Leaf 2	2.404
	CRR073302	Leaf 3	0.438
	CRR073303	Juvenile bud 1	37.028
	CRR073304	Juvenile bud 2	39.804
	CRR073305	Juvenile bud 3	2.764
	CRR073306	Third green 1	18.369
	CRR073307	Third green 2	18.743
	CRR073308	Third green 3	18.601
	CRR073309	Second white 1	0.416
	CRR073310	Second white 2	3.162
	CRR073311	Second white 3	2.376
	CRR073312	Silver flowering 1	14.023
	CRR073313	Silver flowering 2	9.839
	CRR073314	Silver flowering 3	8.244
	CRR073315	Gold flowering 1	9.244
	CRR073316	Gold flowering 2	3.242
	CRR073317	Gold flowering 3	2.648
	CRR073318	Tawny withering 1	16.061
	CRR073319	Tawny withering 2	19.178
	CRR073320	Tawny withering 3	13.979