Gene detail

Detail information of GWHGAAZE026748

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007206013.1	1.25515E-77	hypothetical protein PRUPE_ppa012382mg [Prunus persica]
Swissprot	tr\|Q8VYK4\|NFYB8_ARATH	3E-68	Nuclear transcription factor Y subunit B-8
trEMBL	tr\|M5W0F2\|M5W0F2_PRUPE	5E-78	Uncharacterized protein {ECO:0000313\|EMBL:EMJ07212.1}
TAIR10	AT2G37060.3	2E-54	nuclear factor Y, subunit B8

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	9493752	9494595	+
GWHAAZE00000008	mRNA	9493752	9494595	+
GWHAAZE00000008	exon	9493752	9493969	+
GWHAAZE00000008	exon	9494412	9494595	+
GWHAAZE00000008	CDS	9493752	9493969	+
GWHAAZE00000008	CDS	9494412	9494595	+

Transcript Sequence
>GWHTAAZE026782 ATGGCGGATGCTCCGGCGAGTCCAGGCGGCGGCAGCCACGAGAGCGGAGGGGACCAGAGCCCTCGTTCCAACGTGAGAGAGCAGGACCGCTACCTACCGATCGCCAACATCAGTAGGATCATGAAGAAGGCTTTGCCTGCTAATGGAAAAATCGCCAAGGACGCTAAGGATACTGTTCAGGAATGCGTCTCCGAGTTCATCAGTTTCATCACCAGCGAGGCTAGTGATAAGTGTCAGAAAGAGAAGAGAAAGACAATCAACGGCGATGATTTGTTGTGGGCAATGGCAACATTAGGTTTTGAAGATTACATTGATCCACTTAAGGCGTACCTAGCTAGGTACAGAGAGGTAAACTCTTTATCTTTGGGTCATATCGGTTTGGTGTTTGTTCTTCTTATATAA

Network for GWHGAAZE026748

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00808.24	CBFD_NFYB_HMF	31	95	3.10E-28

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NF-YB

KEGG pathway

KO	Enzyme	pathway	mapID
K08065	NFYB, HAP3	Antigen processing and presentation	map04612

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0005634	cellular_component	nucleus
GO:0046982	molecular_function	protein heterodimerization activity
GO:0043565	molecular_function	sequence-specific DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	34.992
	SRR3591706	second leaf	17.344
	SRR3591707	mature leaf	14.682
	SRR3591708	Shoot apex	46.411
	SRR3591709	Stem	44.471
	SRR3591710	White floral bud	38.772
	SRR3591711	White flower	52.118
	SRR3591712	Green floral bud	33.572
	SRR3591713	Yellow flower	62.825
SRP173429	SRR8316895	Juvenile bud stage	29.021
	SRR8316896	Juvenile bud stage	36.696
	SRR8316897	Juvenile bud stage	17.260
	SRR8316894	Third green stage	15.116
	SRR8316900	Third green stage	36.733
	SRR8316901	Third green stage	39.871
	SRR8316898	Complete white stage	26.406
	SRR8316899	Complete white stage	65.468
	SRR8316903	Complete white stage	33.496
	SRR8316902	Silver flowering stage	23.307
	SRR8316904	Silver flowering stage	27.580
	SRR8316905	Silver flowering stage	19.694
	SRR8316906	Gold flowering stage	68.897
	SRR8316907	Gold flowering stage	66.064
	SRR8316908	Gold flowering stage	72.920
SRP132670	SRR6706286	Control	50.676
	SRR6706287	Light intensity 50%	52.343
	SRR6706288	Light intensity 20%	51.350
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	24.917
	CNS0095593	Slightly white alabastrum(diploid) 2	32.098
	CNS0095594	Slightly white alabastrum(diploid) 3	22.651
	CNS0095595	Whole white alabastrum(diploid) 2	24.175
	CNS0095596	Whole white alabastrum(diploid) 3	16.283
	CNS0095597	Whole white alabastrum(diploid) 4	20.412
	CNS0095598	Silvery flower (diploied) 1	37.515
	CNS0095599	Silvery flower (diploied) 2	37.339
	CNS0095600	Silvery flower (diploied) 3	53.855
	CNS0095601	Golden flower (diploid) 1	36.468
	CNS0095602	Golden flower (diploid) 2	66.021
	CNS0095603	Golden flower (diploid) 3	63.890
	CNS0095604	Slightly white alabastrum(tetraploid) 1	21.948
	CNS0095605	Slightly white alabastrum(tetraploid) 2	16.976
	CNS0095606	Slightly white alabastrum(tetraploid) 3	33.006
	CNS0095607	Whole white alabastrum(tetraploid) 1	15.531
	CNS0095608	Whole white alabastrum(tetraploid) 2	7.566
	CNS0095609	Whole white alabastrum(tetraploid) 3	17.322
	CNS0095610	Silvery flower (tetraploid) 1	31.038
	CNS0095611	Silvery flower (tetraploid) 2	41.377
	CNS0095612	Silvery flower (tetraploid) 3	28.966
	CNS0095613	Golden flower (tetraploid) 1	25.810
	CNS0095614	Golden flower (tetraploid) 2	34.063
	CNS0095615	Golden flower (tetraploid) 3	61.106
CRA001975	CRR073297	Stem 1	45.354
	CRR073298	Stem 2	43.444
	CRR073299	Stem 3	61.028
	CRR073300	Leaf 1	46.376
	CRR073301	Leaf 2	49.362
	CRR073302	Leaf 3	55.275
	CRR073303	Juvenile bud 1	54.592
	CRR073304	Juvenile bud 2	48.325
	CRR073305	Juvenile bud 3	56.880
	CRR073306	Third green 1	55.551
	CRR073307	Third green 2	52.898
	CRR073308	Third green 3	45.914
	CRR073309	Second white 1	50.138
	CRR073310	Second white 2	52.796
	CRR073311	Second white 3	52.103
	CRR073312	Silver flowering 1	65.087
	CRR073313	Silver flowering 2	84.428
	CRR073314	Silver flowering 3	72.182
	CRR073315	Gold flowering 1	21.499
	CRR073316	Gold flowering 2	26.173
	CRR073317	Gold flowering 3	37.269
	CRR073318	Tawny withering 1	61.758
	CRR073319	Tawny withering 2	57.335
	CRR073320	Tawny withering 3	64.238