Gene detail

Detail information of GWHGAAZE026720

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDP44176.1	1.19362E-73	hypothetical protein JCGZ_05643 [Jatropha curcas]
Swissprot	tr\|Q9M5L0\|RL35_EUPES	7E-73	60S ribosomal protein L35
trEMBL	tr\|A0A067L6U3\|A0A067L6U3_JATCU	4E-74	Uncharacterized protein {ECO:0000313\|EMBL:KDP44176.1}
TAIR10	AT5G02610.1	1E-45	Ribosomal L29 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	9134573	9137044	+
GWHAAZE00000008	mRNA	9134573	9137044	+
GWHAAZE00000008	exon	9134573	9134706	+
GWHAAZE00000008	exon	9135321	9135477	+
GWHAAZE00000008	exon	9136720	9137044	+
GWHAAZE00000008	CDS	9134573	9134706	+
GWHAAZE00000008	CDS	9135321	9135477	+
GWHAAZE00000008	CDS	9136720	9136794	+
GWHAAZE00000008	three_prime_UTR	9136795	9137044	+

Transcript Sequence
>GWHTAAZE026754 AGGATTAAGGTGCACGAGCTTAGGAACAAGAACAAGGGGGAGTTGTTGAGCCAGTTGAAAGATCTGAAGGCTGAGCTTGCACTTCTTCGAGTTGCCAAGGTCACCGGTGGTGCCCCCAACAAGCTCTCCAAGATCAAAGTGGTGAGGTTGTCAATTGCACAGGTTTTGACTGTGATTCAGCAGAAACAAAAGGCCGCTCTCAGGGAGGCGTACAAGAACAAGAAATTATTGCCTCTTGATCTGCGCCCCAAGAAAACCAGAGCAATTCGCAAACGTCTTACCAAACACCAGGCGTCTTTGAAGACTGAAAGGGAGAAGAAGAAAGAGATGTACTTCCCCATGAGAAAGTATGCTATTAAGGTGTAGCAACGTAGAAGATGTTACTGAGTAGTAAATTTAAGGTAGAGGTTTCATTAGAGAGAAGATTTTTTGTGCTTTTTAAAAAAAAAATAAAAAAAATTCCTATTCCAGTTCTGAACTTTGCGTTTTTGTTTTATTCACATTTCAATTTCTACACATGTGTGCGTGTTTGTCCATTGTGCAATCTTGGAAAATTTCTCCCAAGTACTTTTACTTTGGAAATGCAGTAATAGTTGAAAGATTTTTTGTTGGTGGA

Network for GWHGAAZE026720

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00831.24	Ribosomal_L29	6	62	6.00E-17

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02918	RP-L35e, RPL35	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	109.381
	SRR3591706	second leaf	49.100
	SRR3591707	mature leaf	22.883
	SRR3591708	Shoot apex	123.477
	SRR3591709	Stem	53.956
	SRR3591710	White floral bud	46.217
	SRR3591711	White flower	57.424
	SRR3591712	Green floral bud	100.183
	SRR3591713	Yellow flower	37.805
SRP173429	SRR8316895	Juvenile bud stage	62.091
	SRR8316896	Juvenile bud stage	93.298
	SRR8316897	Juvenile bud stage	48.107
	SRR8316894	Third green stage	31.366
	SRR8316900	Third green stage	108.785
	SRR8316901	Third green stage	88.774
	SRR8316898	Complete white stage	16.517
	SRR8316899	Complete white stage	90.665
	SRR8316903	Complete white stage	36.075
	SRR8316902	Silver flowering stage	15.713
	SRR8316904	Silver flowering stage	14.526
	SRR8316905	Silver flowering stage	8.910
	SRR8316906	Gold flowering stage	28.944
	SRR8316907	Gold flowering stage	28.635
	SRR8316908	Gold flowering stage	38.004
SRP132670	SRR6706286	Control	95.141
	SRR6706287	Light intensity 50%	96.675
	SRR6706288	Light intensity 20%	108.717
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	121.289
	CNS0095593	Slightly white alabastrum(diploid) 2	132.172
	CNS0095594	Slightly white alabastrum(diploid) 3	110.111
	CNS0095595	Whole white alabastrum(diploid) 2	95.514
	CNS0095596	Whole white alabastrum(diploid) 3	110.321
	CNS0095597	Whole white alabastrum(diploid) 4	74.814
	CNS0095598	Silvery flower (diploied) 1	55.570
	CNS0095599	Silvery flower (diploied) 2	45.953
	CNS0095600	Silvery flower (diploied) 3	37.998
	CNS0095601	Golden flower (diploid) 1	32.970
	CNS0095602	Golden flower (diploid) 2	34.203
	CNS0095603	Golden flower (diploid) 3	31.596
	CNS0095604	Slightly white alabastrum(tetraploid) 1	53.354
	CNS0095605	Slightly white alabastrum(tetraploid) 2	39.802
	CNS0095606	Slightly white alabastrum(tetraploid) 3	60.305
	CNS0095607	Whole white alabastrum(tetraploid) 1	29.804
	CNS0095608	Whole white alabastrum(tetraploid) 2	25.789
	CNS0095609	Whole white alabastrum(tetraploid) 3	45.355
	CNS0095610	Silvery flower (tetraploid) 1	20.360
	CNS0095611	Silvery flower (tetraploid) 2	16.233
	CNS0095612	Silvery flower (tetraploid) 3	16.489
	CNS0095613	Golden flower (tetraploid) 1	14.244
	CNS0095614	Golden flower (tetraploid) 2	19.595
	CNS0095615	Golden flower (tetraploid) 3	11.036
CRA001975	CRR073297	Stem 1	106.013
	CRR073298	Stem 2	116.008
	CRR073299	Stem 3	119.665
	CRR073300	Leaf 1	113.121
	CRR073301	Leaf 2	129.345
	CRR073302	Leaf 3	152.284
	CRR073303	Juvenile bud 1	123.109
	CRR073304	Juvenile bud 2	91.284
	CRR073305	Juvenile bud 3	79.355
	CRR073306	Third green 1	25.278
	CRR073307	Third green 2	25.119
	CRR073308	Third green 3	33.814
	CRR073309	Second white 1	24.869
	CRR073310	Second white 2	28.013
	CRR073311	Second white 3	18.181
	CRR073312	Silver flowering 1	23.057
	CRR073313	Silver flowering 2	23.536
	CRR073314	Silver flowering 3	14.798
	CRR073315	Gold flowering 1	41.901
	CRR073316	Gold flowering 2	47.024
	CRR073317	Gold flowering 3	34.286
	CRR073318	Tawny withering 1	129.246
	CRR073319	Tawny withering 2	109.169
	CRR073320	Tawny withering 3	144.525