Gene detail

Detail information of GWHGAAZE026621

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009629737.1	1.5228E-136	PREDICTED: ras-related protein Rab2BV-like [Nicotiana tomentosiformis]
COG	YP_008431664.1	5E-24	hypothetical protein N186_01315
Swissprot	tr\|Q39434\|RB2BV_BETVU	4E-130	Ras-related protein Rab2BV
trEMBL	tr\|A0A068TVV2\|A0A068TVV2_COFCA	2E-136	Coffea canephora DH200=94 genomic scaffold, scaffold_4 {ECO:0000313\|EMBL:CDP00152.1}
TAIR10	AT1G07410.1	5E-100	RAB GTPase homolog A2B

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	7590811	7597349	+
GWHAAZE00000008	mRNA	7590811	7597349	+
GWHAAZE00000008	exon	7590811	7591011	+
GWHAAZE00000008	exon	7596867	7597349	+
GWHAAZE00000008	CDS	7590811	7591011	+
GWHAAZE00000008	CDS	7596867	7597349	+

Transcript Sequence
>GWHTAAZE026655 ATGGCGTATAAGGTGGATCACGAGTACGATTATCTATTCAAGATCGTGTTGATTGGGGATTCTGGTGTTGGTAAATCCAACATACTCTCCAGGTTTACCAGGAATGAATTCTGCTTGGAATCTAAATCCACCATTGGTGTTGAATTTGCTACTAGGACTCTTCAGGTATGTTTGTTTTTTTGTTTCTTTATTTTTGCAAATGTAGAGGGGAAGACAGTGAAGGCACAAATATGGGACACAGCGGGACAGGAGAGGTACCGAGCCATCACGAGCGCGTATTACCGTGGTGCAGTTGGGGCCCTCTTGGTGTATGATATAACCAAATGGCAAACCTTCGAGAACGTGCAGAGGTGGCTCCGAGAGCTGAGGGACCACGCGGATTCCAACATAGTGATAATGCTGGCCGGCAACAAGTCTGACTTGAACCACCTCCGTGCAGTTCCCGAGAAGGATGCTAGGCAACTGGCCGAGAACGAGAGCCTCTCGTTCCTTGAGACCTCGGCCTTGGAAGCATTTAATGTGGAAAAAGCGTTTCAAACCATCATGTTGGACATTTATCAAGTGATGAGCCGAAAGGCGTTAGCAGCTCAAGAGGCAGCTTCTTCGGTCCCCGGTCAAGGCACCACAATTAACGTCGGGGATTATTCCGGTAATGGTGGCAAAAGAACTTGTTGTAGTAATTAA

Network for GWHGAAZE026621

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00071.23	Ras	14	186	1.30E-56

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07904	RAB11A	Endocytosis	map04144
		Pancreatic secretion	map04972
		Vasopressin-regulated water reabsorption	map04962
		Endocrine and other factor-regulated calcium reabsorption	map04961

Gene Ontology

GO term	Ontology	Name
GO:0005525	molecular_function	GTP binding
GO:0003924	molecular_function	GTPase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.275
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.930
	SRR3591709	Stem	0.521
	SRR3591710	White floral bud	24.706
	SRR3591711	White flower	0.408
	SRR3591712	Green floral bud	52.420
	SRR3591713	Yellow flower	0.233
SRP173429	SRR8316895	Juvenile bud stage	3.722
	SRR8316896	Juvenile bud stage	15.466
	SRR8316897	Juvenile bud stage	5.235
	SRR8316894	Third green stage	6.260
	SRR8316900	Third green stage	37.528
	SRR8316901	Third green stage	42.051
	SRR8316898	Complete white stage	0.056
	SRR8316899	Complete white stage	0.367
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.132
	SRR8316904	Silver flowering stage	0.476
	SRR8316905	Silver flowering stage	0.137
	SRR8316906	Gold flowering stage	0.523
	SRR8316907	Gold flowering stage	0.166
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	16.862
	SRR6706287	Light intensity 50%	17.126
	SRR6706288	Light intensity 20%	15.121
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	27.018
	CNS0095593	Slightly white alabastrum(diploid) 2	23.628
	CNS0095594	Slightly white alabastrum(diploid) 3	31.221
	CNS0095595	Whole white alabastrum(diploid) 2	60.961
	CNS0095596	Whole white alabastrum(diploid) 3	73.930
	CNS0095597	Whole white alabastrum(diploid) 4	96.998
	CNS0095598	Silvery flower (diploied) 1	0.346
	CNS0095599	Silvery flower (diploied) 2	3.946
	CNS0095600	Silvery flower (diploied) 3	0.474
	CNS0095601	Golden flower (diploid) 1	0.641
	CNS0095602	Golden flower (diploid) 2	0.282
	CNS0095603	Golden flower (diploid) 3	0.344
	CNS0095604	Slightly white alabastrum(tetraploid) 1	55.815
	CNS0095605	Slightly white alabastrum(tetraploid) 2	73.587
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.659
	CNS0095607	Whole white alabastrum(tetraploid) 1	140.070
	CNS0095608	Whole white alabastrum(tetraploid) 2	171.943
	CNS0095609	Whole white alabastrum(tetraploid) 3	82.020
	CNS0095610	Silvery flower (tetraploid) 1	0.302
	CNS0095611	Silvery flower (tetraploid) 2	1.773
	CNS0095612	Silvery flower (tetraploid) 3	4.395
	CNS0095613	Golden flower (tetraploid) 1	0.571
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	2.419
CRA001975	CRR073297	Stem 1	7.320
	CRR073298	Stem 2	7.379
	CRR073299	Stem 3	4.720
	CRR073300	Leaf 1	29.172
	CRR073301	Leaf 2	17.699
	CRR073302	Leaf 3	13.416
	CRR073303	Juvenile bud 1	26.108
	CRR073304	Juvenile bud 2	37.266
	CRR073305	Juvenile bud 3	0.500
	CRR073306	Third green 1	5.506
	CRR073307	Third green 2	9.226
	CRR073308	Third green 3	8.427
	CRR073309	Second white 1	0.330
	CRR073310	Second white 2	0.289
	CRR073311	Second white 3	0.571
	CRR073312	Silver flowering 1	4.790
	CRR073313	Silver flowering 2	3.960
	CRR073314	Silver flowering 3	3.605
	CRR073315	Gold flowering 1	5.972
	CRR073316	Gold flowering 2	3.638
	CRR073317	Gold flowering 3	5.143
	CRR073318	Tawny withering 1	4.416
	CRR073319	Tawny withering 2	6.522
	CRR073320	Tawny withering 3	4.759