Gene detail

Detail information of GWHGAAZE026570

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AIC33056.1	5.43759E-75	F-box containing protein [Panax ginseng]
Swissprot	tr\|Q9FFF5\|ALFL1_ARATH	9E-59	PHD finger protein ALFIN-LIKE 1
trEMBL	tr\|A0A060IGF7\|A0A060IGF7_PANGI	2E-75	F-box containing protein {ECO:0000313\|EMBL:AIC33056.1}
TAIR10	AT5G05610.2	1E-43	alfin-like 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	6700578	6702738	-
GWHAAZE00000008	mRNA	6700578	6702738	-
GWHAAZE00000008	exon	6700578	6700832	-
GWHAAZE00000008	exon	6701367	6701487	-
GWHAAZE00000008	exon	6702564	6702603	-
GWHAAZE00000008	exon	6702702	6702738	-
GWHAAZE00000008	CDS	6702702	6702738	-
GWHAAZE00000008	CDS	6702564	6702603	-
GWHAAZE00000008	CDS	6701367	6701487	-
GWHAAZE00000008	CDS	6700578	6700832	-

Transcript Sequence
>GWHTAAZE026604 ATGAAGGGTGAGGTTTTCTTTAACTACCTTGTCAATGAAGTTGAACTTAAGCGATCAGCAATGCTGGACAACGAAATGAAGCGTCTATTTAGCCTGATAAATGACCTACCGACAGTCTTTGAAGTTGTAACGGAGAGGAAGCCCATTAAGGACAAGCCCAGTGTGGACAGCGGGAGCAAATCCAAGATCAGCACCAAGAAATCAAACAACGAACAGCCAAAAGTGAACCCTAGACTATATGACGAGAGCTACGTGGAAGATGAAGATGAGCACGGTGAAACCCTATGTGGGAGTTGTGGGGGAAACTACAGTGCAGACGAGTTCTGGATTGGATGCGACATTTGTGAGAGGTGGTACCACGGCAAGTGCGTCAAAATAACGCCGGCCAAGGCTGAGAATATCAAGCAGTACAAATGCCCTTCTTGCAGCACAAAGAGGGGGAGGCAGCAGTAA

Network for GWHGAAZE026570

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00628.30	PHD	96	144	3.40E-11

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	Alfin-like

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	92.796
	SRR3591706	second leaf	75.301
	SRR3591707	mature leaf	67.848
	SRR3591708	Shoot apex	118.995
	SRR3591709	Stem	100.563
	SRR3591710	White floral bud	81.268
	SRR3591711	White flower	89.257
	SRR3591712	Green floral bud	105.507
	SRR3591713	Yellow flower	82.553
SRP173429	SRR8316895	Juvenile bud stage	53.818
	SRR8316896	Juvenile bud stage	78.342
	SRR8316897	Juvenile bud stage	34.369
	SRR8316894	Third green stage	27.000
	SRR8316900	Third green stage	76.647
	SRR8316901	Third green stage	81.298
	SRR8316898	Complete white stage	26.223
	SRR8316899	Complete white stage	87.345
	SRR8316903	Complete white stage	42.717
	SRR8316902	Silver flowering stage	26.738
	SRR8316904	Silver flowering stage	25.163
	SRR8316905	Silver flowering stage	17.548
	SRR8316906	Gold flowering stage	46.035
	SRR8316907	Gold flowering stage	52.690
	SRR8316908	Gold flowering stage	48.158
SRP132670	SRR6706286	Control	60.820
	SRR6706287	Light intensity 50%	62.835
	SRR6706288	Light intensity 20%	64.601
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	88.309
	CNS0095593	Slightly white alabastrum(diploid) 2	90.482
	CNS0095594	Slightly white alabastrum(diploid) 3	90.893
	CNS0095595	Whole white alabastrum(diploid) 2	67.032
	CNS0095596	Whole white alabastrum(diploid) 3	64.587
	CNS0095597	Whole white alabastrum(diploid) 4	50.411
	CNS0095598	Silvery flower (diploied) 1	67.108
	CNS0095599	Silvery flower (diploied) 2	69.848
	CNS0095600	Silvery flower (diploied) 3	57.562
	CNS0095601	Golden flower (diploid) 1	71.437
	CNS0095602	Golden flower (diploid) 2	55.203
	CNS0095603	Golden flower (diploid) 3	55.398
	CNS0095604	Slightly white alabastrum(tetraploid) 1	84.325
	CNS0095605	Slightly white alabastrum(tetraploid) 2	81.530
	CNS0095606	Slightly white alabastrum(tetraploid) 3	114.403
	CNS0095607	Whole white alabastrum(tetraploid) 1	53.416
	CNS0095608	Whole white alabastrum(tetraploid) 2	46.336
	CNS0095609	Whole white alabastrum(tetraploid) 3	74.747
	CNS0095610	Silvery flower (tetraploid) 1	65.359
	CNS0095611	Silvery flower (tetraploid) 2	59.203
	CNS0095612	Silvery flower (tetraploid) 3	36.847
	CNS0095613	Golden flower (tetraploid) 1	51.783
	CNS0095614	Golden flower (tetraploid) 2	64.628
	CNS0095615	Golden flower (tetraploid) 3	32.421
CRA001975	CRR073297	Stem 1	96.607
	CRR073298	Stem 2	90.162
	CRR073299	Stem 3	111.596
	CRR073300	Leaf 1	96.309
	CRR073301	Leaf 2	102.665
	CRR073302	Leaf 3	99.377
	CRR073303	Juvenile bud 1	100.921
	CRR073304	Juvenile bud 2	81.707
	CRR073305	Juvenile bud 3	104.545
	CRR073306	Third green 1	25.373
	CRR073307	Third green 2	31.678
	CRR073308	Third green 3	30.379
	CRR073309	Second white 1	27.353
	CRR073310	Second white 2	24.880
	CRR073311	Second white 3	22.526
	CRR073312	Silver flowering 1	28.960
	CRR073313	Silver flowering 2	27.744
	CRR073314	Silver flowering 3	18.319
	CRR073315	Gold flowering 1	72.135
	CRR073316	Gold flowering 2	67.747
	CRR073317	Gold flowering 3	66.894
	CRR073318	Tawny withering 1	122.800
	CRR073319	Tawny withering 2	109.215
	CRR073320	Tawny withering 3	118.258