Gene detail

Detail information of GWHGAAZE026519

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP13938.1	5.2378E-101	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9LYL9\|Y3623_ARATH	4E-66	BTB/POZ domain-containing protein At3g56230
trEMBL	tr\|A0A068V215\|A0A068V215_COFCA	2E-101	Coffea canephora DH200=94 genomic scaffold, scaffold_78 {ECO:0000313\|EMBL:CDP13938.1}
TAIR10	AT3G56230.1	3E-49	BTB/POZ domain-containing protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	5831707	5832615	+
GWHAAZE00000008	mRNA	5831707	5832615	+
GWHAAZE00000008	exon	5831707	5831883	+
GWHAAZE00000008	exon	5832169	5832615	+
GWHAAZE00000008	CDS	5831707	5831883	+
GWHAAZE00000008	CDS	5832169	5832615	+

Transcript Sequence
>GWHTAAZE026553 GGATTTGCAAATGCTTTGAGATGGATCAAGGAAACTAAGGAAATGGAAGAGGAACTTAATGATAAGTTGGTGTATCTGGGTAGCTTTGTTGCCTCTTTTAAAGAGAAAATTCACACTGATATTCAGGTCTTGCCTGGCGATAATGGACTCCCCATTCCCACTCATAGAGCATTACTGGCTATAAGATCAAACATATTGAAGAACATGTTGGGCTCAGATGGGTACATGGCACCACCGAATGACACAATTGCCTTCCCTGAATTCACCTATGAAGAACTAGAGTGCCTCTTAGAGTTCCTCTATAGTGGTCACTTGACCAAAGAAAAAGTTGAGAAACATGTTTATTCATTGTCAATTGCTGCAGACAAATATGAGATCCCATTTTTGGCAAAATTTTGTGAGAATCAAATGCGCAAGTCCTTAAATTCCAACAATGCCCTTGAGGTGCTAGAGATATCAGACACTTGTTCTAACCAGAGCTTGAAGGAGGCTGTTTTGAAATTTATTGTTAAGAATATGGGTGATATTGTCTTTTCAGCTAAGTTTGATGCGTTTGCACTTAAGAATCCCCACTTGAGTGTGGAGATTACTAGGGCTTCTTTTATAGATGGTCATAATATATAA

Network for GWHGAAZE026519

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00651.32	BTB	32	140	7.00E-18

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	TRAF
Ubiquitin Family	3-box

KEGG pathway

KO	Enzyme	pathway	mapID
K10523	SPOP	Hedgehog signaling pathway	map04340
K10523	SPOP	Hedgehog signaling pathway - fly	map04341

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.686
	SRR3591706	second leaf	2.027
	SRR3591707	mature leaf	0.640
	SRR3591708	Shoot apex	2.602
	SRR3591709	Stem	0.470
	SRR3591710	White floral bud	0.741
	SRR3591711	White flower	0.209
	SRR3591712	Green floral bud	3.474
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	3.151
	SRR8316896	Juvenile bud stage	7.507
	SRR8316897	Juvenile bud stage	2.876
	SRR8316894	Third green stage	2.181
	SRR8316900	Third green stage	4.608
	SRR8316901	Third green stage	5.206
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.126
	SRR8316903	Complete white stage	0.139
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.866
	SRR6706287	Light intensity 50%	0.735
	SRR6706288	Light intensity 20%	1.127
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.711
	CNS0095593	Slightly white alabastrum(diploid) 2	3.557
	CNS0095594	Slightly white alabastrum(diploid) 3	7.098
	CNS0095595	Whole white alabastrum(diploid) 2	4.391
	CNS0095596	Whole white alabastrum(diploid) 3	3.621
	CNS0095597	Whole white alabastrum(diploid) 4	4.970
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.081
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.093
	CNS0095603	Golden flower (diploid) 3	0.368
	CNS0095604	Slightly white alabastrum(tetraploid) 1	5.882
	CNS0095605	Slightly white alabastrum(tetraploid) 2	6.367
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.235
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.874
	CNS0095608	Whole white alabastrum(tetraploid) 2	6.173
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.122
	CNS0095610	Silvery flower (tetraploid) 1	0.304
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.081
	CNS0095615	Golden flower (tetraploid) 3	0.111
CRA001975	CRR073297	Stem 1	1.646
	CRR073298	Stem 2	0.669
	CRR073299	Stem 3	0.680
	CRR073300	Leaf 1	0.474
	CRR073301	Leaf 2	0.460
	CRR073302	Leaf 3	0.066
	CRR073303	Juvenile bud 1	0.268
	CRR073304	Juvenile bud 2	0.173
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.063
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.435
	CRR073316	Gold flowering 2	0.181
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000