Gene detail

Detail information of GWHGAAZE026462

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009794195.1	8.7325E-131	PREDICTED: putative casein kinase II subunit beta-4 [Nicotiana sylvestris]
Swissprot	tr\|P40228\|CSK2B_ARATH	1E-128	Casein kinase II subunit beta
trEMBL	tr\|V7CEG3\|V7CEG3_PHAVU	1E-131	Uncharacterized protein {ECO:0000313\|EMBL:ESW28597.1}
TAIR10	AT2G44680.1	9E-93	casein kinase II beta subunit 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	5031789	5037744	+
GWHAAZE00000008	mRNA	5031789	5037744	+
GWHAAZE00000008	exon	5031789	5031855	+
GWHAAZE00000008	exon	5032891	5033109	+
GWHAAZE00000008	exon	5036560	5036669	+
GWHAAZE00000008	exon	5036768	5036933	+
GWHAAZE00000008	exon	5037614	5037744	+
GWHAAZE00000008	CDS	5031789	5031855	+
GWHAAZE00000008	CDS	5032891	5033109	+
GWHAAZE00000008	CDS	5036560	5036669	+
GWHAAZE00000008	CDS	5036768	5036933	+
GWHAAZE00000008	CDS	5037614	5037744	+

Transcript Sequence
>GWHTAAZE026496 ATGAACAAAGATCCAGTCAAGCTCTCCGCTTCAACTACGAAGAAGAACAGGAGTATGGTCTCTGAGGAGGAATCTGAAACATCCAGTGAAGAGTCGGACGTTAGTGGTTCTGAAGGGGAAGATATATCCTGGATCTCATGGTTTTGCAATCTGAAAGGACATGAATTCTTCTGCGAAGTTGATGACGACTATATTCAAGATGATTTTAACCTTTGTGGGTTAAGCGGTCAAGTCCCATACTATGATTATGCCCTTGACTTAATTTTAGATGTTGAGTCATCTCATGATGATAAACTCAGTGATGAACAGAATGCATTGGTTGAATCAGCGTCAGAGATGCTTTATGGCCTAATTCATGCGCGTTACATACTAACTACCAAAGGGATGTCTGCCATGTTGGAGAAGTACAAGAACTATGAATTTGGGACATGCCCAAGGGCTTATTGTTCTGAACAGCAATGTCTTCCAGTTGGCCAGTCAGATATACCGCGATCAAGTTATGTGAGAATCTACTGTCCAAAGTGTGAAGATATTTACTTGCCACGAACCAAATACCAATACGCCATTGACGGAGCATATTTCGGGACTACATTCCCCCACTTGTTTCTGATGACATACGGGCACCTCAAGCCACAACCCCCGTCTCAGAACTATGTTCCGAGGGTATTTGGCTTCAAAGTCCATAAGCCATAG

Network for GWHGAAZE026462

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01214.19	CK_II_beta	43	226	2.80E-79

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03115	CSNK2B	Ribosome biogenesis in eukaryotes	map03008
		Wnt signaling pathway	map04310
		NF-kappa B signaling pathway	map04064
		Mitophagy - animal	map04137
		Mitophagy - yeast	map04139
		Adherens junction	map04520
		Circadian rhythm - plant	map04712

Gene Ontology

GO term	Ontology	Name
GO:0005956	cellular_component	protein kinase CK2 complex
GO:0019887	molecular_function	protein kinase regulator activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	44.332
	SRR3591706	second leaf	29.080
	SRR3591707	mature leaf	38.815
	SRR3591708	Shoot apex	42.071
	SRR3591709	Stem	61.308
	SRR3591710	White floral bud	60.294
	SRR3591711	White flower	68.409
	SRR3591712	Green floral bud	44.205
	SRR3591713	Yellow flower	55.303
SRP173429	SRR8316895	Juvenile bud stage	39.063
	SRR8316896	Juvenile bud stage	46.790
	SRR8316897	Juvenile bud stage	24.560
	SRR8316894	Third green stage	20.819
	SRR8316900	Third green stage	54.699
	SRR8316901	Third green stage	53.667
	SRR8316898	Complete white stage	37.710
	SRR8316899	Complete white stage	92.313
	SRR8316903	Complete white stage	60.301
	SRR8316902	Silver flowering stage	48.476
	SRR8316904	Silver flowering stage	60.751
	SRR8316905	Silver flowering stage	26.817
	SRR8316906	Gold flowering stage	70.391
	SRR8316907	Gold flowering stage	75.104
	SRR8316908	Gold flowering stage	71.332
SRP132670	SRR6706286	Control	28.207
	SRR6706287	Light intensity 50%	33.928
	SRR6706288	Light intensity 20%	34.876
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	47.182
	CNS0095593	Slightly white alabastrum(diploid) 2	39.685
	CNS0095594	Slightly white alabastrum(diploid) 3	41.690
	CNS0095595	Whole white alabastrum(diploid) 2	36.197
	CNS0095596	Whole white alabastrum(diploid) 3	30.317
	CNS0095597	Whole white alabastrum(diploid) 4	36.043
	CNS0095598	Silvery flower (diploied) 1	49.236
	CNS0095599	Silvery flower (diploied) 2	47.261
	CNS0095600	Silvery flower (diploied) 3	57.631
	CNS0095601	Golden flower (diploid) 1	53.235
	CNS0095602	Golden flower (diploid) 2	57.273
	CNS0095603	Golden flower (diploid) 3	52.058
	CNS0095604	Slightly white alabastrum(tetraploid) 1	38.372
	CNS0095605	Slightly white alabastrum(tetraploid) 2	37.340
	CNS0095606	Slightly white alabastrum(tetraploid) 3	50.590
	CNS0095607	Whole white alabastrum(tetraploid) 1	29.888
	CNS0095608	Whole white alabastrum(tetraploid) 2	25.774
	CNS0095609	Whole white alabastrum(tetraploid) 3	38.286
	CNS0095610	Silvery flower (tetraploid) 1	60.601
	CNS0095611	Silvery flower (tetraploid) 2	59.721
	CNS0095612	Silvery flower (tetraploid) 3	62.526
	CNS0095613	Golden flower (tetraploid) 1	52.050
	CNS0095614	Golden flower (tetraploid) 2	57.040
	CNS0095615	Golden flower (tetraploid) 3	46.825
CRA001975	CRR073297	Stem 1	54.892
	CRR073298	Stem 2	43.428
	CRR073299	Stem 3	45.997
	CRR073300	Leaf 1	47.648
	CRR073301	Leaf 2	43.321
	CRR073302	Leaf 3	32.716
	CRR073303	Juvenile bud 1	35.215
	CRR073304	Juvenile bud 2	40.831
	CRR073305	Juvenile bud 3	30.559
	CRR073306	Third green 1	50.288
	CRR073307	Third green 2	52.843
	CRR073308	Third green 3	44.966
	CRR073309	Second white 1	32.881
	CRR073310	Second white 2	63.359
	CRR073311	Second white 3	34.017
	CRR073312	Silver flowering 1	16.101
	CRR073313	Silver flowering 2	13.344
	CRR073314	Silver flowering 3	14.022
	CRR073315	Gold flowering 1	33.258
	CRR073316	Gold flowering 2	43.890
	CRR073317	Gold flowering 3	24.243
	CRR073318	Tawny withering 1	52.313
	CRR073319	Tawny withering 2	67.962
	CRR073320	Tawny withering 3	65.560