Gene detail

Detail information of GWHGAAZE026457

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002279047.1	1.30125E-76	PREDICTED: mediator of RNA polymerase II transcription subunit 31 [Vitis vinifera]
Swissprot	tr\|Q8VYB1\|MED31_ARATH	3E-61	Mediator of RNA polymerase II transcription subunit 31
trEMBL	tr\|D7T7W9\|D7T7W9_VITVI	5E-77	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI26590.3}
TAIR10	AT5G19910.1	2E-47	SOH1 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	4950680	4953566	-
GWHAAZE00000008	mRNA	4950680	4953566	-
GWHAAZE00000008	exon	4950680	4950955	-
GWHAAZE00000008	exon	4952231	4952309	-
GWHAAZE00000008	exon	4952491	4952587	-
GWHAAZE00000008	exon	4953539	4953566	-
GWHAAZE00000008	CDS	4953539	4953566	-
GWHAAZE00000008	CDS	4952491	4952587	-
GWHAAZE00000008	CDS	4952231	4952309	-
GWHAAZE00000008	CDS	4950680	4950955	-

Transcript Sequence
>GWHTAAZE026491 ATGATTCGGCCACTACCACTCCTTCCTCATTTGGCCCAGAACCGTTATTTTGAAGATGAAGCTTTCATTGGCTACTTGAAATACCTTCAATACTGGCAAAGACCGGAATACGTAAAATTTATAATGTATCCACATTGCCTCTACTTTCTTGAACTTCTCCAAAACGCAAACTTCCGCAATGCAATGGCACACCCTGGCAACAAGGAATTGGCACACAGGCAACAATTCTATTTTTGGAAGAACTACAGAAACAACAGATTGAAGCATATACTACCAAGGCCTCTTCCCGAACCTGTCTCTGCACCACAAGCCTCGGCCCCATCTCCGGCGCCTGTGCCACACACAACTAATTCCATTTCTGCTCCTGTTCCTACTGGTGGTCCAGCACTCTCCCCAATGCAGTATGCTATTCCCTCTGGATCTTCTCTCACAAAGAATGATCCCAGGAACAGTGTGGTTGATCGAAGAAAGAGAAAGTAA

Network for GWHGAAZE026457

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF05669.13	Med31	8	82	8.70E-25

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	SOH1

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0016592	cellular_component	mediator complex
GO:0003712	molecular_function	transcription coregulator activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	12.582
	SRR3591706	second leaf	11.930
	SRR3591707	mature leaf	10.041
	SRR3591708	Shoot apex	24.816
	SRR3591709	Stem	20.713
	SRR3591710	White floral bud	19.797
	SRR3591711	White flower	18.729
	SRR3591712	Green floral bud	23.391
	SRR3591713	Yellow flower	15.734
SRP173429	SRR8316895	Juvenile bud stage	16.641
	SRR8316896	Juvenile bud stage	20.702
	SRR8316897	Juvenile bud stage	13.000
	SRR8316894	Third green stage	7.994
	SRR8316900	Third green stage	17.579
	SRR8316901	Third green stage	20.309
	SRR8316898	Complete white stage	7.716
	SRR8316899	Complete white stage	27.802
	SRR8316903	Complete white stage	13.211
	SRR8316902	Silver flowering stage	7.854
	SRR8316904	Silver flowering stage	8.978
	SRR8316905	Silver flowering stage	4.813
	SRR8316906	Gold flowering stage	14.393
	SRR8316907	Gold flowering stage	14.325
	SRR8316908	Gold flowering stage	12.853
SRP132670	SRR6706286	Control	27.517
	SRR6706287	Light intensity 50%	24.342
	SRR6706288	Light intensity 20%	27.260
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	20.405
	CNS0095593	Slightly white alabastrum(diploid) 2	22.848
	CNS0095594	Slightly white alabastrum(diploid) 3	16.163
	CNS0095595	Whole white alabastrum(diploid) 2	15.348
	CNS0095596	Whole white alabastrum(diploid) 3	13.845
	CNS0095597	Whole white alabastrum(diploid) 4	14.467
	CNS0095598	Silvery flower (diploied) 1	16.583
	CNS0095599	Silvery flower (diploied) 2	10.738
	CNS0095600	Silvery flower (diploied) 3	17.779
	CNS0095601	Golden flower (diploid) 1	11.764
	CNS0095602	Golden flower (diploid) 2	15.926
	CNS0095603	Golden flower (diploid) 3	15.553
	CNS0095604	Slightly white alabastrum(tetraploid) 1	15.049
	CNS0095605	Slightly white alabastrum(tetraploid) 2	13.340
	CNS0095606	Slightly white alabastrum(tetraploid) 3	16.048
	CNS0095607	Whole white alabastrum(tetraploid) 1	6.997
	CNS0095608	Whole white alabastrum(tetraploid) 2	10.051
	CNS0095609	Whole white alabastrum(tetraploid) 3	11.980
	CNS0095610	Silvery flower (tetraploid) 1	13.273
	CNS0095611	Silvery flower (tetraploid) 2	16.509
	CNS0095612	Silvery flower (tetraploid) 3	11.528
	CNS0095613	Golden flower (tetraploid) 1	11.173
	CNS0095614	Golden flower (tetraploid) 2	10.754
	CNS0095615	Golden flower (tetraploid) 3	12.298
CRA001975	CRR073297	Stem 1	19.074
	CRR073298	Stem 2	17.117
	CRR073299	Stem 3	16.555
	CRR073300	Leaf 1	13.864
	CRR073301	Leaf 2	16.488
	CRR073302	Leaf 3	18.250
	CRR073303	Juvenile bud 1	19.227
	CRR073304	Juvenile bud 2	17.108
	CRR073305	Juvenile bud 3	20.346
	CRR073306	Third green 1	6.698
	CRR073307	Third green 2	6.666
	CRR073308	Third green 3	6.721
	CRR073309	Second white 1	6.392
	CRR073310	Second white 2	5.865
	CRR073311	Second white 3	4.314
	CRR073312	Silver flowering 1	6.052
	CRR073313	Silver flowering 2	3.791
	CRR073314	Silver flowering 3	1.914
	CRR073315	Gold flowering 1	17.592
	CRR073316	Gold flowering 2	14.873
	CRR073317	Gold flowering 3	15.860
	CRR073318	Tawny withering 1	10.203
	CRR073319	Tawny withering 2	18.049
	CRR073320	Tawny withering 3	18.143