Gene detail

Detail information of GWHGAAZE026439

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009804349.1	5.71236E-47	PREDICTED: ethylene-responsive transcription factor ERF106 [Nicotiana sylvestris]
Swissprot	tr\|Q9LY05\|EF106_ARATH	8E-38	Ethylene-responsive transcription factor ERF106
trEMBL	tr\|E3VVR8\|E3VVR8_PETHY	6E-44	Ethylene-responsive-element-binding factor 9 {ECO:0000313\|EMBL:ADP37424.1}
TAIR10	AT5G07580.1	1E-31	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	4722152	4722709	-
GWHAAZE00000008	mRNA	4722152	4722709	-
GWHAAZE00000008	exon	4722152	4722709	-
GWHAAZE00000008	CDS	4722152	4722709	-

Transcript Sequence
>GWHTAAZE026473 ATGACTCAACAAGAACTCTTAACAATAGAACTCATACACTACCATCTCCTCGGAGAAATCAATTCCACAGAGACCCACATAGACAACCTCAATTTCCACATTTCCCATGATGAGTCCCTTGTTATCTCCGAAGAATCGAACCGTTCTTGCTCCGAATCCGGATCAAATTGTCTCAATGCAGATCCAACCCACTGCGATTCACTAGCTTCTGTATCCAAATTCGTAAATCCAGACCGCAATTGCTCAGACTACGAAACGAAACTCGAAATAGTCGACTTAAATACAACATTACCAAATTCTGTCAAGGGCTTGGATTTTAAAGATGTTACGCATTACAGGGGAGTTAAGAGGCGTCCATGGGGCAAGTTCGTGGCGGAGATCCGGGACCCGACCCGGAAAGGGTCTCGGGTCTGGCTGGGGACCTACTCTACGGATATCGAGGCAGCGAAGGCTTATGACTTTGCAGCGTTTAAAATGAGGGGGAGCAGAGCGATACTGAACTTTCCGGTGGATGCCGGAAAATATGAACCGCCGGAAAAGATTGGACGGAAGAGGTGA

Network for GWHGAAZE026439

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	110	161	3.00E-14

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.426
	SRR3591706	second leaf	0.125
	SRR3591707	mature leaf	0.298
	SRR3591708	Shoot apex	2.753
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.675
	SRR3591711	White flower	2.066
	SRR3591712	Green floral bud	0.239
	SRR3591713	Yellow flower	1.456
SRP173429	SRR8316895	Juvenile bud stage	0.221
	SRR8316896	Juvenile bud stage	0.354
	SRR8316897	Juvenile bud stage	0.116
	SRR8316894	Third green stage	0.608
	SRR8316900	Third green stage	0.667
	SRR8316901	Third green stage	0.604
	SRR8316898	Complete white stage	0.239
	SRR8316899	Complete white stage	0.664
	SRR8316903	Complete white stage	0.468
	SRR8316902	Silver flowering stage	1.164
	SRR8316904	Silver flowering stage	1.537
	SRR8316905	Silver flowering stage	0.216
	SRR8316906	Gold flowering stage	2.540
	SRR8316907	Gold flowering stage	1.712
	SRR8316908	Gold flowering stage	6.643
SRP132670	SRR6706286	Control	0.997
	SRR6706287	Light intensity 50%	1.031
	SRR6706288	Light intensity 20%	0.870
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.555
	CNS0095593	Slightly white alabastrum(diploid) 2	0.281
	CNS0095594	Slightly white alabastrum(diploid) 3	2.361
	CNS0095595	Whole white alabastrum(diploid) 2	0.390
	CNS0095596	Whole white alabastrum(diploid) 3	0.785
	CNS0095597	Whole white alabastrum(diploid) 4	0.583
	CNS0095598	Silvery flower (diploied) 1	0.609
	CNS0095599	Silvery flower (diploied) 2	0.345
	CNS0095600	Silvery flower (diploied) 3	0.737
	CNS0095601	Golden flower (diploid) 1	1.409
	CNS0095602	Golden flower (diploid) 2	0.607
	CNS0095603	Golden flower (diploid) 3	1.825
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.462
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.730
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.826
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.519
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.597
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.583
	CNS0095610	Silvery flower (tetraploid) 1	2.087
	CNS0095611	Silvery flower (tetraploid) 2	0.632
	CNS0095612	Silvery flower (tetraploid) 3	0.507
	CNS0095613	Golden flower (tetraploid) 1	2.150
	CNS0095614	Golden flower (tetraploid) 2	1.830
	CNS0095615	Golden flower (tetraploid) 3	2.342
CRA001975	CRR073297	Stem 1	1.364
	CRR073298	Stem 2	0.600
	CRR073299	Stem 3	0.948
	CRR073300	Leaf 1	1.107
	CRR073301	Leaf 2	0.547
	CRR073302	Leaf 3	1.825
	CRR073303	Juvenile bud 1	0.856
	CRR073304	Juvenile bud 2	0.404
	CRR073305	Juvenile bud 3	0.975
	CRR073306	Third green 1	9.627
	CRR073307	Third green 2	8.142
	CRR073308	Third green 3	8.496
	CRR073309	Second white 1	1.804
	CRR073310	Second white 2	1.386
	CRR073311	Second white 3	1.573
	CRR073312	Silver flowering 1	1.049
	CRR073313	Silver flowering 2	1.187
	CRR073314	Silver flowering 3	0.946
	CRR073315	Gold flowering 1	0.911
	CRR073316	Gold flowering 2	2.639
	CRR073317	Gold flowering 3	0.991
	CRR073318	Tawny withering 1	2.463
	CRR073319	Tawny withering 2	0.778
	CRR073320	Tawny withering 3	0.778