Gene detail

Detail information of GWHGAAZE026334

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ACB45078.1	5.43355E-83	CRT binding factor 3 [Solanum habrochaites]
Swissprot	tr\|P93835\|DRE1B_ARATH	9E-68	Dehydration-responsive element-binding protein 1B
trEMBL	tr\|B3TPN5\|B3TPN5_SOLHA	2E-83	CRT binding factor 3 {ECO:0000313\|EMBL:ACB45078.1}
TAIR10	AT4G25490.1	5E-55	C-repeat/DRE binding factor 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	2997878	2998513	+
GWHAAZE00000008	mRNA	2997878	2998513	+
GWHAAZE00000008	exon	2997878	2998513	+
GWHAAZE00000008	CDS	2997878	2998513	+

Transcript Sequence
>GWHTAAZE026368 ATGTGCAGTCATTATTATGAAACGCCGGAATCATCTGACAGCAGCAGTGCCGGAAAATCAAATCATCCTAACGAAGAAGTCATGCTAGCTTCTGAAAATCCGAAAAAGCGTGCCGGAAGAAAAAAGGTTAATGAAACTCGGCACCCGGTATATCGAGGTATTAGAAAACGAAGCGGCGGAAAATGGGTGTCTGAGGTGAGAGAACCAAACAAAAAGAATTCCAGAATATGGCTCGGCACTTTCCCCACTGCCGAGATGGCCGCCAGGGCCCACGACGTTGCAGCCATCGCCTTTAGAGGAAGGTCAGCCTGCCTCAATTTTGCTGACTCAGTCTGGCGGCTTCCTGTCCCAGTCACTGCAAGTGCCAAGGATATTCAGAAGGCAGCAGTCGAGGCAGCAGATATGTTCCGGCTGACGGAGTCAGAGGGGACATTGCGCGAGAATTTAATGGAGGAGAGTGTTGGGGAGTCGCCAGAAACTGTGTTTTACGTGGATGAAGAGGTTGTTTTTGACATGCCAGGATTACTAACAGATATGGCAGAGGGGATGATGGTGCCTCCACCTCCACCACTACTTCAGTGGGTCGGAGATGAAGATGGAGTTATTGGGGATGAAATGTACTTGTGGAGTTATTAG

Network for GWHGAAZE026334

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	49	100	4.70E-13

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	103.239
	SRR3591706	second leaf	10.345
	SRR3591707	mature leaf	2.043
	SRR3591708	Shoot apex	42.434
	SRR3591709	Stem	46.135
	SRR3591710	White floral bud	36.283
	SRR3591711	White flower	19.251
	SRR3591712	Green floral bud	22.030
	SRR3591713	Yellow flower	8.567
SRP173429	SRR8316895	Juvenile bud stage	226.838
	SRR8316896	Juvenile bud stage	183.424
	SRR8316897	Juvenile bud stage	173.236
	SRR8316894	Third green stage	27.888
	SRR8316900	Third green stage	46.140
	SRR8316901	Third green stage	121.089
	SRR8316898	Complete white stage	0.486
	SRR8316899	Complete white stage	200.532
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.862
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	1.025
	SRR8316906	Gold flowering stage	10.096
	SRR8316907	Gold flowering stage	4.830
	SRR8316908	Gold flowering stage	0.650
SRP132670	SRR6706286	Control	2.622
	SRR6706287	Light intensity 50%	3.853
	SRR6706288	Light intensity 20%	1.063
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	99.137
	CNS0095593	Slightly white alabastrum(diploid) 2	227.040
	CNS0095594	Slightly white alabastrum(diploid) 3	209.651
	CNS0095595	Whole white alabastrum(diploid) 2	180.092
	CNS0095596	Whole white alabastrum(diploid) 3	11.048
	CNS0095597	Whole white alabastrum(diploid) 4	96.763
	CNS0095598	Silvery flower (diploied) 1	342.459
	CNS0095599	Silvery flower (diploied) 2	386.067
	CNS0095600	Silvery flower (diploied) 3	124.541
	CNS0095601	Golden flower (diploid) 1	358.838
	CNS0095602	Golden flower (diploid) 2	246.520
	CNS0095603	Golden flower (diploid) 3	233.172
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.054
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.010
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.071
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.185
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.117
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	1.309
	CNS0095611	Silvery flower (tetraploid) 2	0.065
	CNS0095612	Silvery flower (tetraploid) 3	4.206
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.079
	CNS0095615	Golden flower (tetraploid) 3	0.396
CRA001975	CRR073297	Stem 1	61.140
	CRR073298	Stem 2	80.057
	CRR073299	Stem 3	75.024
	CRR073300	Leaf 1	137.857
	CRR073301	Leaf 2	198.148
	CRR073302	Leaf 3	96.551
	CRR073303	Juvenile bud 1	68.050
	CRR073304	Juvenile bud 2	142.881
	CRR073305	Juvenile bud 3	175.060
	CRR073306	Third green 1	41.758
	CRR073307	Third green 2	61.682
	CRR073308	Third green 3	26.878
	CRR073309	Second white 1	32.272
	CRR073310	Second white 2	26.316
	CRR073311	Second white 3	29.108
	CRR073312	Silver flowering 1	53.535
	CRR073313	Silver flowering 2	42.234
	CRR073314	Silver flowering 3	29.140
	CRR073315	Gold flowering 1	70.833
	CRR073316	Gold flowering 2	80.576
	CRR073317	Gold flowering 3	81.472
	CRR073318	Tawny withering 1	13.105
	CRR073319	Tawny withering 2	78.239
	CRR073320	Tawny withering 3	9.396