Gene detail

Detail information of GWHGAAZE026299

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDP22276.1	1.37476E-84	hypothetical protein JCGZ_26107 [Jatropha curcas]
Swissprot	tr\|Q67ZM4\|ADF7_ARATH	3E-82	Actin-depolymerizing factor 7
trEMBL	tr\|A0A067JEI3\|A0A067JEI3_JATCU	5E-85	Uncharacterized protein {ECO:0000313\|EMBL:KDP22276.1}
TAIR10	AT4G25590.1	9E-65	actin depolymerizing factor 7

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	2376176	2377126	+
GWHAAZE00000008	mRNA	2376176	2377126	+
GWHAAZE00000008	exon	2376176	2376435	+
GWHAAZE00000008	exon	2376976	2377126	+
GWHAAZE00000008	CDS	2376176	2376435	+
GWHAAZE00000008	CDS	2376976	2377126	+

Transcript Sequence
>GWHTAAZE026333 GCGAACGCGGCATCTGGAATGGCTGTGCATGACAGCTGCAAACTCAAGTTTTTGGAACTAAAATCAAAGCGGAACCACCGATACATTATCTTCAAAATTGAGGACCAGCAAGTGATTGTGGACAAGCTGGGGAGTCCTAATGCTAGCTACGAGGAGTTCACCTCAGCATTCCCCTCTGATGAGTGTCGCTATGCCGTCTATGATTTTGATTTCACTACCGATGAGAATTGCCAGAAAAGCAAAATTTTCTTCATCGCTTGGTCCCCTGATAGCTCCAGGGTGAGGATGAAGATGGTTTATGCTAGCTCCAAGGACAGATTCAAGAGAGAGCTGGATGGGATCCAAGTTGAGTTGCAAGCTACTGATCCAAGTGAAATGAGCCTTGACATTATAAAAGGCCGAGCCATCTAA

Network for GWHGAAZE026299

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00241.21	Cofilin_ADF	13	132	4.70E-39

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K05765	CFL	Regulation of actin cytoskeleton	map04810
		Fc gamma R-mediated phagocytosis	map04666
		Axon guidance	map04360

Gene Ontology

GO term	Ontology	Name
GO:0030042	biological_process	actin filament depolymerization
GO:0015629	cellular_component	actin cytoskeleton
GO:0003779	molecular_function	actin binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.758
	SRR3591706	second leaf	0.628
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	1.354
	SRR3591709	Stem	0.726
	SRR3591710	White floral bud	153.758
	SRR3591711	White flower	6.539
	SRR3591712	Green floral bud	276.164
	SRR3591713	Yellow flower	2.528
SRP173429	SRR8316895	Juvenile bud stage	72.515
	SRR8316896	Juvenile bud stage	203.642
	SRR8316897	Juvenile bud stage	88.777
	SRR8316894	Third green stage	70.947
	SRR8316900	Third green stage	270.506
	SRR8316901	Third green stage	311.802
	SRR8316898	Complete white stage	0.535
	SRR8316899	Complete white stage	2.560
	SRR8316903	Complete white stage	0.295
	SRR8316902	Silver flowering stage	3.529
	SRR8316904	Silver flowering stage	3.580
	SRR8316905	Silver flowering stage	0.803
	SRR8316906	Gold flowering stage	0.324
	SRR8316907	Gold flowering stage	0.171
	SRR8316908	Gold flowering stage	0.306
SRP132670	SRR6706286	Control	83.122
	SRR6706287	Light intensity 50%	83.486
	SRR6706288	Light intensity 20%	75.509
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	160.270
	CNS0095593	Slightly white alabastrum(diploid) 2	114.141
	CNS0095594	Slightly white alabastrum(diploid) 3	226.531
	CNS0095595	Whole white alabastrum(diploid) 2	194.300
	CNS0095596	Whole white alabastrum(diploid) 3	263.352
	CNS0095597	Whole white alabastrum(diploid) 4	194.764
	CNS0095598	Silvery flower (diploied) 1	6.039
	CNS0095599	Silvery flower (diploied) 2	16.985
	CNS0095600	Silvery flower (diploied) 3	2.302
	CNS0095601	Golden flower (diploid) 1	5.965
	CNS0095602	Golden flower (diploid) 2	2.914
	CNS0095603	Golden flower (diploid) 3	3.042
	CNS0095604	Slightly white alabastrum(tetraploid) 1	318.185
	CNS0095605	Slightly white alabastrum(tetraploid) 2	298.724
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.850
	CNS0095607	Whole white alabastrum(tetraploid) 1	429.848
	CNS0095608	Whole white alabastrum(tetraploid) 2	531.080
	CNS0095609	Whole white alabastrum(tetraploid) 3	346.956
	CNS0095610	Silvery flower (tetraploid) 1	2.054
	CNS0095611	Silvery flower (tetraploid) 2	13.429
	CNS0095612	Silvery flower (tetraploid) 3	35.061
	CNS0095613	Golden flower (tetraploid) 1	4.129
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	20.364
CRA001975	CRR073297	Stem 1	78.568
	CRR073298	Stem 2	69.980
	CRR073299	Stem 3	55.258
	CRR073300	Leaf 1	99.001
	CRR073301	Leaf 2	102.161
	CRR073302	Leaf 3	107.989
	CRR073303	Juvenile bud 1	91.996
	CRR073304	Juvenile bud 2	149.996
	CRR073305	Juvenile bud 3	5.089
	CRR073306	Third green 1	43.217
	CRR073307	Third green 2	77.358
	CRR073308	Third green 3	48.671
	CRR073309	Second white 1	5.642
	CRR073310	Second white 2	9.016
	CRR073311	Second white 3	10.700
	CRR073312	Silver flowering 1	38.342
	CRR073313	Silver flowering 2	36.765
	CRR073314	Silver flowering 3	23.286
	CRR073315	Gold flowering 1	62.749
	CRR073316	Gold flowering 2	9.516
	CRR073317	Gold flowering 3	34.097
	CRR073318	Tawny withering 1	42.645
	CRR073319	Tawny withering 2	54.252
	CRR073320	Tawny withering 3	39.330