Gene detail

Detail information of GWHGAAZE026268

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	NP_001275178.1	5.9796E-107	40S ribosomal protein S10-like [Solanum tuberosum]
Swissprot	tr\|Q9AYP4\|RS10_ORYSJ	3E-73	40S ribosomal protein S10
trEMBL	tr\|Q2XPV4\|Q2XPV4_SOLTU	2E-107	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400075267}
TAIR10	AT5G52650.1	8E-40	RNA binding Plectin/S10 domain-containing protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	1665140	1667758	+
GWHAAZE00000008	mRNA	1665140	1667758	+
GWHAAZE00000008	exon	1665140	1665447	+
GWHAAZE00000008	exon	1665749	1665884	+
GWHAAZE00000008	exon	1667477	1667758	+
GWHAAZE00000008	CDS	1665140	1665447	+
GWHAAZE00000008	CDS	1665749	1665884	+
GWHAAZE00000008	CDS	1667477	1667557	+
GWHAAZE00000008	three_prime_UTR	1667558	1667758	+

Transcript Sequence
>GWHTAAZE026302 ATGCTATTTGTTTTGAATGTGCCTACAGAGGGGGTTTGCTTTGCGAAGAAGGACTACAATCTTGCAAAGCATCCAGAAATCGATGTGCCGAATCTGCAAGTGATTAAGCTGATGCAAAGCTTCAAATCAAAGGAGTATGTGCGAGAGACTTTCGCTTGGATGCATTACTATTGGTACCTTACCAATGATGGCATCGAGTTTCTCAGGACTTACCTCAATCTTCCATCTGACATTGTCCCTTCCACTTTGAAGAAGTCAGCCAAGCCCCTTGGTCGTCCCATGGGTGGCCCGCCTGGCGATCGCCCCCGTGGCCCACCAAGATTTGAAGGAGACCGACCAAGGTTTGGTGACAGGGATGGGTACCGTGGGGGTCCAAGAGGGCCTCCTGGTGAATTTGGTGGTGAAAAGGGTGGAGCTCCAGCTGATTACCAGCCTGCTTTTAGGGGTGGTTCGGGTGGAAGACCTGGTTTTGGACGCGGAGCAGGAGGTTTTGGGGGAGAACCACCCAGTTCGAGCTTTTCGTGAATCGTTTTGAATTTTTACTGAGAATTTTGTAGTGTTTTCAACGGATTAGGGTTCTGGTTTGGAACATTGTCACCCACATACTCCAGTTTGAAATTTGCTTAATTTGTCCTCGTTAAATGCACAATATATAATTGTTATGTGACCATTCTATAAATTATGTTCCCATTTGGTTGTGTTGGTAATGCGTTTCTTGGGTTTATA

Network for GWHGAAZE026268

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03501.16	S10_plectin	9	86	2.10E-36

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02947	RP-S10e, RPS10	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	226.203
	SRR3591706	second leaf	79.679
	SRR3591707	mature leaf	33.809
	SRR3591708	Shoot apex	281.549
	SRR3591709	Stem	100.335
	SRR3591710	White floral bud	72.014
	SRR3591711	White flower	87.994
	SRR3591712	Green floral bud	171.203
	SRR3591713	Yellow flower	60.478
SRP173429	SRR8316895	Juvenile bud stage	93.308
	SRR8316896	Juvenile bud stage	137.796
	SRR8316897	Juvenile bud stage	82.109
	SRR8316894	Third green stage	58.522
	SRR8316900	Third green stage	208.547
	SRR8316901	Third green stage	194.913
	SRR8316898	Complete white stage	22.858
	SRR8316899	Complete white stage	110.119
	SRR8316903	Complete white stage	32.292
	SRR8316902	Silver flowering stage	15.190
	SRR8316904	Silver flowering stage	14.275
	SRR8316905	Silver flowering stage	6.049
	SRR8316906	Gold flowering stage	20.004
	SRR8316907	Gold flowering stage	23.422
	SRR8316908	Gold flowering stage	45.629
SRP132670	SRR6706286	Control	77.584
	SRR6706287	Light intensity 50%	74.297
	SRR6706288	Light intensity 20%	82.505
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	279.406
	CNS0095593	Slightly white alabastrum(diploid) 2	364.080
	CNS0095594	Slightly white alabastrum(diploid) 3	293.729
	CNS0095595	Whole white alabastrum(diploid) 2	256.414
	CNS0095596	Whole white alabastrum(diploid) 3	333.650
	CNS0095597	Whole white alabastrum(diploid) 4	209.973
	CNS0095598	Silvery flower (diploied) 1	105.035
	CNS0095599	Silvery flower (diploied) 2	93.131
	CNS0095600	Silvery flower (diploied) 3	43.299
	CNS0095601	Golden flower (diploid) 1	72.101
	CNS0095602	Golden flower (diploid) 2	43.936
	CNS0095603	Golden flower (diploid) 3	43.658
	CNS0095604	Slightly white alabastrum(tetraploid) 1	273.599
	CNS0095605	Slightly white alabastrum(tetraploid) 2	298.216
	CNS0095606	Slightly white alabastrum(tetraploid) 3	242.663
	CNS0095607	Whole white alabastrum(tetraploid) 1	178.669
	CNS0095608	Whole white alabastrum(tetraploid) 2	155.116
	CNS0095609	Whole white alabastrum(tetraploid) 3	206.839
	CNS0095610	Silvery flower (tetraploid) 1	54.552
	CNS0095611	Silvery flower (tetraploid) 2	38.480
	CNS0095612	Silvery flower (tetraploid) 3	34.837
	CNS0095613	Golden flower (tetraploid) 1	33.995
	CNS0095614	Golden flower (tetraploid) 2	44.709
	CNS0095615	Golden flower (tetraploid) 3	15.610
CRA001975	CRR073297	Stem 1	182.970
	CRR073298	Stem 2	180.628
	CRR073299	Stem 3	249.385
	CRR073300	Leaf 1	169.067
	CRR073301	Leaf 2	195.386
	CRR073302	Leaf 3	351.312
	CRR073303	Juvenile bud 1	239.784
	CRR073304	Juvenile bud 2	166.816
	CRR073305	Juvenile bud 3	160.050
	CRR073306	Third green 1	16.900
	CRR073307	Third green 2	23.844
	CRR073308	Third green 3	20.493
	CRR073309	Second white 1	24.343
	CRR073310	Second white 2	18.431
	CRR073311	Second white 3	10.046
	CRR073312	Silver flowering 1	22.123
	CRR073313	Silver flowering 2	32.284
	CRR073314	Silver flowering 3	29.758
	CRR073315	Gold flowering 1	92.520
	CRR073316	Gold flowering 2	78.888
	CRR073317	Gold flowering 3	81.600
	CRR073318	Tawny withering 1	209.143
	CRR073319	Tawny withering 2	193.975
	CRR073320	Tawny withering 3	248.288