Gene detail

Detail information of GWHGAAZE026078

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002285373.1	6.19791E-92	PREDICTED: protein PPLZ02 [Vitis vinifera]
Swissprot	tr\|Q94AW5\|ERF03_ARATH	1E-73	Ethylene-responsive transcription factor ERF003
trEMBL	tr\|F6H3U5\|F6H3U5_VITVI	2E-92	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB46834.1}
TAIR10	AT5G25190.1	1E-41	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	72913827	72914576	+
GWHAAZE00000007	mRNA	72913827	72914576	+
GWHAAZE00000007	exon	72913827	72913909	+
GWHAAZE00000007	exon	72914081	72914576	+
GWHAAZE00000007	CDS	72913827	72913909	+
GWHAAZE00000007	CDS	72914081	72914576	+

Transcript Sequence
>GWHTAAZE026112 ATGGCTAGGCATCAACAAAGGTATCGTGGGGTTCGACAGAGGCATTGGGGCTCTTGGGTTTCTGAAATTCGCCATCCTTTGCTTAAGACTAGAATTTGGCTAGGCACATTTGAGACGGCTGAGGACGCGGCTCGAGCATACGACGAAGCAGCTCGGCTAATGTGCGGGCCGAGGGCTCGAACCAACTTCCCTTACAACCCGAATGCGAGCCAATCTTCATCGGCTAAGCTTCTTTCGGCTACTTTGACCGCTAAATTGCACAAGTGCTATATGGCTTCACTCCAAATGACCAAACAATCAATGCAGGAGCCTCAAAGGGTTCTTTCTTCTAATGCCATAACGGCTAGACGCATTGCCGGAACGCCTGCCGGACCAGCTGTTTGGTTGCCAGAGGAGGTGAATAAGCCAATGGCAGTGCCACACGTGGAGGCAAAGGATTGGGTTATCAAGAAAGTGCAAGTCGAGACCACCCATCAACAATTTAAGCCCCTTGAAGATGACCATATAGAGCAAATGATTGAGGAGTTGCTTGATTATGGGTCTATTGAACTCTGCCCTGTGGCCTCACCTCTAAAATAA

Network for GWHGAAZE026078

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	7	56	8.20E-12

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	11.106
	SRR3591706	second leaf	0.902
	SRR3591707	mature leaf	0.391
	SRR3591708	Shoot apex	6.832
	SRR3591709	Stem	12.538
	SRR3591710	White floral bud	2.107
	SRR3591711	White flower	2.724
	SRR3591712	Green floral bud	6.011
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	2.108
	SRR8316896	Juvenile bud stage	0.455
	SRR8316897	Juvenile bud stage	1.424
	SRR8316894	Third green stage	1.387
	SRR8316900	Third green stage	17.131
	SRR8316901	Third green stage	11.027
	SRR8316898	Complete white stage	0.417
	SRR8316899	Complete white stage	22.306
	SRR8316903	Complete white stage	3.532
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.093
	SRR8316905	Silver flowering stage	0.097
	SRR8316906	Gold flowering stage	0.089
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	1.290
SRP132670	SRR6706286	Control	35.950
	SRR6706287	Light intensity 50%	50.810
	SRR6706288	Light intensity 20%	62.480
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	7.634
	CNS0095593	Slightly white alabastrum(diploid) 2	7.695
	CNS0095594	Slightly white alabastrum(diploid) 3	2.767
	CNS0095595	Whole white alabastrum(diploid) 2	13.704
	CNS0095596	Whole white alabastrum(diploid) 3	16.647
	CNS0095597	Whole white alabastrum(diploid) 4	12.476
	CNS0095598	Silvery flower (diploied) 1	4.182
	CNS0095599	Silvery flower (diploied) 2	4.935
	CNS0095600	Silvery flower (diploied) 3	3.285
	CNS0095601	Golden flower (diploid) 1	8.577
	CNS0095602	Golden flower (diploid) 2	7.092
	CNS0095603	Golden flower (diploid) 3	5.013
	CNS0095604	Slightly white alabastrum(tetraploid) 1	9.837
	CNS0095605	Slightly white alabastrum(tetraploid) 2	9.442
	CNS0095606	Slightly white alabastrum(tetraploid) 3	12.296
	CNS0095607	Whole white alabastrum(tetraploid) 1	9.718
	CNS0095608	Whole white alabastrum(tetraploid) 2	11.144
	CNS0095609	Whole white alabastrum(tetraploid) 3	22.412
	CNS0095610	Silvery flower (tetraploid) 1	0.708
	CNS0095611	Silvery flower (tetraploid) 2	0.669
	CNS0095612	Silvery flower (tetraploid) 3	0.495
	CNS0095613	Golden flower (tetraploid) 1	0.074
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.157
CRA001975	CRR073297	Stem 1	6.791
	CRR073298	Stem 2	6.225
	CRR073299	Stem 3	7.021
	CRR073300	Leaf 1	21.342
	CRR073301	Leaf 2	22.922
	CRR073302	Leaf 3	19.682
	CRR073303	Juvenile bud 1	18.983
	CRR073304	Juvenile bud 2	12.617
	CRR073305	Juvenile bud 3	10.929
	CRR073306	Third green 1	0.814
	CRR073307	Third green 2	0.069
	CRR073308	Third green 3	0.402
	CRR073309	Second white 1	0.187
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.431
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	55.267
	CRR073316	Gold flowering 2	57.102
	CRR073317	Gold flowering 3	20.494
	CRR073318	Tawny withering 1	79.680
	CRR073319	Tawny withering 2	46.346
	CRR073320	Tawny withering 3	62.561